Jurkat cells (2 × 106) were transfected in Nucleofector solution (Nucleofector Kit V, program X-01; Amaxa Biosystems) with 2 μM of nonsense siRNA (Qiagen), Bid siRNA (Qiagen) or Bim siRNA (Qiagen) using the Nucleofector apparatus. MT-2 cells were transfected in Nucleofector solution (Nucleofector Kit V, program O-17; Amaxa Biosystems) with 2 μM of nonsense siRNA (Qiagen) or HIF-1α siRNA (Qiagen). Seventy-two hours after transfection, cells were collected for protein expression analysis and different treatments as indicated in the figure legends.
Nucleofector solution
Manufactured by Lonza
Sourced in Switzerland, United States, Germany
The Nucleofector solution is a specialized cell transfection reagent used for the efficient delivery of nucleic acids, such as plasmids or siRNA, into a variety of cell types. It facilitates the introduction of these molecules into the cell's nucleus, enabling various downstream applications, including gene expression studies, gene knockdown, and cellular reprogramming.
Automatically generated - may contain errors
Lab products found in correlation
Opti mem, by Thermo Fisher Scientific (4 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Silencer select pre designed sirna, by Thermo Fisher Scientific (3 mentions)
4d nucleofector, by Lonza (3 mentions)
Neurobasal medium, by Thermo Fisher Scientific (3 mentions)
Nucleofector 2, by Lonza (2 mentions)
4d nucleofector x unit, by Lonza (2 mentions)
Nucleofector 2b device, by Lonza (2 mentions)
Nucleofector kit, by Lonza (2 mentions)
Amaxa 4d nucleofector system, by Lonza (2 mentions)
Human b cell nucleofector kit, by Lonza (2 mentions)
Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Nucleofector kit 5, by Lonza (1 mentions)
Nonsense sirna, by Qiagen (1 mentions)
Hif 1α sirna, by Qiagen (1 mentions)
Amaxa nucleofector system, by Lonza (1 mentions)
On targetplus smartpool, by Horizon Discovery (1 mentions)
Cas9 2nls nuclease, by Synthego (1 mentions)
Inference of crispr edits, by Synthego (1 mentions)
Platinum taq dna polymerase high fidelity, by Thermo Fisher Scientific (1 mentions)
55 protocols using nucleofector solution
1
Transfection of Jurkat and MT-2 Cells
2
CRISPR-Cas9 Genome Editing in Diverse Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNP complexes were assembled by incubating 100 pmol Cas9 and 120 pmol gRNA in a final volume of 10 µl Nuclease-Free Duplex Buffer for 10 min at ambient temperature. 2 × 105 cells were resuspended in 20 µl of 4D Nucleofector Solution SE (Lonza) for Jurkat and HeLa cells, Nucleofector Solution SF for K-562 cells, and Nucleofector Solution P3 Primary Cell for T cells. RNP complex and 100 pmol of donor DNA were added to the cell suspension followed by electroporation with the 4D Nucleofector System (Lonza) using programs CN-114 for HeLa, FF-120 for K-562, CL-120 for Jurkat, and FI-11S for T cells. Cells were then incubated at ambient temperature for 5 min and transferred to a six-well plate containing 2 ml growth medium. At 72 h post-electroporation, cells were analyzed for insertion.
3
Neuronal Plasmid Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transfection of plasmids, neurons were resuspended after dissociation in Lonza Nucleofector solution (VPG-1001) and electroporated with an Amaxa Nucleofector according to manufacturer protocol. HEK cells were transfected using Lipofectamine 2000 (Invitrogen) as per the manufacturer’s protocol.
4
Neuronal and HEK293 Cell Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transfection of plasmids and siRNA, dissociated cortical neurons were resuspended in Lonza Nucleofector solution (VPG-1001) and electroporated with an Amaxa Nucleofector according to the manufacturer’s protocol. HEK293 cells were transfected using Polyplus jetPRIME reagent or Lipofectamine 2000 as per the manufacturer’s protocol.
5
Conditional Gene Knockout in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 5×106 cells were harvested and resuspended in 100 µl of Nucleofector solution (Amaxa), to which 75 µg of endotoxin-free pANMerCreMer plasmid DNA was added. The mix has been transferred to an Amaxa cuvette for “nucleofection.” Nucleofected cells were added to 10 ml of RPMI containing 100 nM 4-OH-Tamoxifen and after growth for 24 h plated into 96-well plates at 0.5/1/1.5 cells per plate. After 7–8 d, subclones were picked and replated under selection for further analyses.
6
Isolation and Nucleofection of MDM Cells
7
siRNA Knockdown of p53 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A siRNA for p53, which targeted the RNA coding sequence, was designed by Dharmacon (ON-TARGET plus SMARTpool, Dharmacon Corporation, Lafayette, CO, USA). Negative control and GAPDH siRNAs were purchased from Ambion (Silencer Select Predesigned siRNA, Ambion, Austin, TX, USA). The siRNAs were transfected through electroporation, as specified in the instruction manual (Amaxa, Germany). After transfection, cells were cultured for 48 h to detect target expression. Briefly, 106 cells were trypsinized and resuspended in 100 μL of Nucleofector solution (Amaxa), and 100 nM of siRNA duplexes was electroporated.
8
CRISPR/Cas9-Mediated Panx2 Knockout in Rat Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 technology was used to generate PANX2 KO REK cells (REK-PANX2KO) according to Synthego’s nucleofection CRISPR protocol. The CRISPRevolution single-guide RNA (sgRNA) EZ kit targeting the beginning of exon 2 of rat Panx2 gene (sequence: GCACAACUUCACCCGUGACC) and Cas9 2NLS nuclease were obtained from Synthego (Menlo Park, CA). One million cells/reaction were used for nucleofection with complexed ribonucleoprotein (9:1, sgRNA-to-Cas9 ratio) and Nucleofector solution L + supplement in a Nucleofector II (Amaxa Biosystems, Germany) according to the manufacturer’s instructions. Expansion and clonal selection were then performed postnucleofection and genomic DNA isolated for genome sequencing and analysis by Inference of CRISPR Edits (Synthego). Platinum Taq DNA High Fidelity polymerase (Invitrogen; REF#11304-011; Carlsbad, CA) was used for PCR to genotype the target region as per the manufacturer instructions using the following primers: Px2-F (5′-GGGGGTTCATTTGGGGAACA-3′) and Px2-R (5′-CAGGAAGTTGAGCTCGGAGG-3′). The genomic deletion was confirmed by Sanger sequencing provided by the London Regional Genomics Centre (Robarts Research Institute, London,ON, Canada).
9
Podocyte Transient Transfection Protocol
10
Silencing NR1D1 and NR1D2 in BMMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All siRNAs were purchased from Invitrogen (now Thermo Fisher, Waltham, MA, USA). Specific siRNAs against NR1D1 (stealthTM RNAi; Nr1d1MSS211361 [3_RNAI]) or NR1D2 (stealthTM RNAi: Nr1d2MSS221355 [3_RNAI]) were used.
Transfection of wild-type BMMCs were performed with Mouse Macrophage Nucleofector Kit (VPA-1009; Lonza, Basel, Switzerland). BMMCs were suspended in Nucleofector Solution to a final concentration of 2 × 106 cells/100μL. The cells were transfected with 500 nM negative control or 250 nM specific siRNA of NR1D1 and NR1D2, respectively, using the Nucleofector II (Amaxa Biosystems, now Lonza) program Y-001. Subsequently, the transferred cells were placed in a 20% FBS medium and cultured in a 24-well plate. After 24 h, the transfected BMMCs were stimulated with anti-mouse IgE antibody (1μg/mL), IL-33 (1 ng/mL), or LPS (1 μg/mL) in the absence or presence of 10 μM SR9009.
Transfection of wild-type BMMCs were performed with Mouse Macrophage Nucleofector Kit (VPA-1009; Lonza, Basel, Switzerland). BMMCs were suspended in Nucleofector Solution to a final concentration of 2 × 106 cells/100μL. The cells were transfected with 500 nM negative control or 250 nM specific siRNA of NR1D1 and NR1D2, respectively, using the Nucleofector II (Amaxa Biosystems, now Lonza) program Y-001. Subsequently, the transferred cells were placed in a 20% FBS medium and cultured in a 24-well plate. After 24 h, the transfected BMMCs were stimulated with anti-mouse IgE antibody (1μg/mL), IL-33 (1 ng/mL), or LPS (1 μg/mL) in the absence or presence of 10 μM SR9009.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!