Trizol plus rna purification kit

Viral inactivation studies were performed at Seattle Children’s Research Institute’s biosafety level 3 facility. Twenty-five μL of SARS-CoV-2 (isolate USA-WA1/2020 obtained from ATCC BEI Resources) viral stock with a titer of 5.8×10⁶ pfu/mL was incubated in 200 μL of TE or TE + 0.25% Triton for 10 minutes at room temperature, or in TE at 65°C for 10 minutes. Untreated and treated SARS-CoV-2 was then added neat and at 10-fold dilutions through 10⁻⁷ to confluent cultures of Vero E6 cells (CRL-1586, ATCC) and 48 hours later cytopathic effects were scored after staining with crystal violet. RNA was isolated from Vero cells using a TRIzol Plus RNA Purification Kit (ThermoFisher) and the amount of SARS-CoV-2 was quantified by RT-qPCR.

Total RNA from plasma exosomes was extracted using the TRIzol Plus RNA Purification Kit (Cat# 12183555, Thermo Fisher Scientific, Waltham, MA, USA). Then, the purified RNA was sent to Yingbiotech (Shanghai, China) for the construction of small RNA libraries. Briefly, the RNA was ligated with adaptors, and complementary DNA strands were created during PCR amplification. A small RNA fragments with length of approximately 15–40 nt were used for quality control. We further quantified and validated the purified libraries. Subsequently, RNA sequencing was performed on a HiSeq 2500 sequencing system (Illumina, San Diego, California, USA).

When the fish reached ∼2 years of age (range 663–703 days, because of differences in fertilization and birth dates), we used tricaine methanesulfonate to kill three randomly chosen fish from one stream family and one lake family from each of Misty and Robert’s watersheds, for a total of 12 fish. All fish were processed on the same day within 15 min of one another. Immediately after death we dissected the liver from the fish that was then flash-frozen in liquid nitrogen. The liver was chosen because it is involved in a number of important processes in stickleback, including metabolism (Leder et al., 2009 (link)), cold tolerance (Orczewska et al., 2010 (link)), energy storage (Chellappa et al., 1989 ; Huntingford et al., 2001 ), immune function (Kurtz et al., 2006 ) and response to hypoxia (Leveelahti et al., 2011 (link)), all of which are related to the ecological differentiation between lake and stream sticklebacks. We then used the TRIzol Plus RNA Purification Kit (Thermo-Fischer Scientific, Waltham, MA, USA) to extract and purify total RNA. We prepared individual libraries using the Illumina TruSeq Stranded mRNA Prep Kit (Illumina, San Diego, CA, USA) and 100 bp, single-end reads were sequenced on two lanes of an Illumina HiSeq 2000, with libraries spread randomly over the two lanes.

Total RNA of MIA Paca-2 cell was extracted by TRIzol plus RNA purification kit (Thermo Fisher Scientific, Waltham, MA, USA) according the description of the manufacturer’s manual. Then, cDNA was synthesis and amplified by reverse transcription-PCR analysis to detect RAGE and 18s (as an internal standard) gene expression. The primers used for amplification were as follows:
RAGE (forward 5′CACCTTCTCCTGTAGCTTCA3′; reverse 5′TGCCACAAGATGACCCCAAT3′);
18s (forward 5′TTGGAGGGCAAGTCTGGTG3′; reverse 5′CCGCTCCCAAGATCCAACTA3′).