Sybr premix ex taqtm tli rnaseh plus kit

Manufactured by Takara Bio

Sourced in Japan, United States, China

The SYBR® Premix Ex TaqTM (Tli RNaseH Plus) kit is a pre-mixed solution designed for real-time PCR amplification and detection. It contains SYBR® Green I dye, a thermostable RNase H-Plus DNA polymerase, and other necessary components for efficient and accurate gene quantification.

Automatically generated - may contain errors

Lab products found in correlation

25 protocols using sybr premix ex taqtm tli rnaseh plus kit

Quantitative Expression Analysis of miR-135a and Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted and transcribed into complementary DNA using a PrimeScript^TM RT reagent kit with gDNA Eraser kit (RRO37A, Takara, Kyoto, Japan). Next, the expression of miR-135a and genes was examined following the instructions of the TaqMan miRNA Assay kit [4440886 (462760_mat) and 4427975 (002232), Thermo Fisher Scientific, Massachusetts, USA] and the SYBR^®Premix Ex Taq^TM kit (Tli RNaseH Plus) (RR820A Takara, Kyoto, Japan). The RT-qPCR was conducted using an ABI 7500 PCR instrument (Thermo Fisher Scientific).
With glyceraldehyde 3-phosphate dehydrogenase (GAPDH) used as the internal control for genes and U6 for miR-135a, the fold changes were calculated using the 2^-ΔΔCt method (17 (link)). The primers (Table 1) used in the experiment were provided by Shanghai GenePharma Co., Ltd. (Shanghai, China).

Ding H., Huang J., Wu D., Zhao J., Huang J, & Lin Q. (2020). Silencing of the long non-coding RNA MEG3 suppresses the apoptosis of aortic endothelial cells in mice with chronic intermittent hypoxia via downregulation of HIF-1α by competitively binding to microRNA-135a. Journal of Thoracic Disease, 12(5), 1903-1916.

+ Open protocol

+ Expand

Quantifying mRNA and miRNA Expression in HUVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from HUVECs using TRIZOL (Invitrogen). Next, total RNA was reversely transcribed into cDNA using the TaqMan™ MicroRNA Reverse Transcription Kit (4366596; Thermo Fisher) and High-Capacity cDNA Reverse Transcription Kit (4368813; Thermo Fisher). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 (Invitrogen) were used as internal reference for mRNA and miRNA amplification, respectively. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was performed using SYBR®Premix Ex TaqTM kit (Tli RNaseH Plus) (RR820A; TaKaRa, Kyoto, Japan) with primers for miR-200a, EZH2, and HMGB1 (designed and synthesized by Invitrogen; Table 1) on the Mx3000p Sequence Detection System (Agilent Technologies, USA). Relative expression levels were determined using the 2^−ΔΔCt method.

Wang J., Li P., Xu X., Zhang B, & Zhang J. (2020). MicroRNA-200a Inhibits Inflammation and Atherosclerotic Lesion Formation by Disrupting EZH2-Mediated Methylation of STAT3. Frontiers in Immunology, 11, 907.

+ Open protocol

+ Expand

Real-Time PCR Analysis of Chloride Channels

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA of the cultured Nthy-ori3-1 cells was extracted using RNAiso Plus reagent (Takara, Japan) and reverse transcribed to cDNA using the Prime Script RT Kit (Takara, Japan). cDNA was amplified using SYBR Premix Ex Taq^TM kit (TliRNaseH Plus; Takara, Japan) following the instructions of the manufacturer: initial step of 95°C/30 s, followed by 40 cycles of 95°C/5 s and 60°C/30 s, and melt analysis at 60–90°C at increments of 0.1°C/s. The primer sequences (Sangon Biotech, China) are as follows (Table 1). Housekeeping gene GAPDH was used as the reference.Table 1.

The primer sequences used for real-time PCR

Gene	Forward sequence (5ʹ to 3ʹ)	Reverse sequence (5ʹ to 3ʹ)	Product size(bp)
ClCN-1	GAATCCCCGAAATGAAGACA	TCCTACCAGCCTTCCAAATG	201
ClCN-2	GCTGTCATTGGTATTGCTAGTGG	AGCGTCTCTTTCTGTGAGAGCTGT	218
ClCN-3	TTGCCTACTATCACCACGAC	GCATCTCCAACCCATTTACT	226
ClCN-4	CCCTGGTACATGGCTGAACT	CTCTGGCGTGTGTAGGGATT	203
ClCN-5	TGGACTCCTCCAAGCTCTGT	AGGCCAGAAGGGATCTTCAT	178
ClCN-6	ATTTGGGTTTCTTCGTCGTG	CGGCATTCTCCTAACACCAT	202
ClCN-7	GGAGAAAATGGCCTACACGA	AGATCAGCACGAAGGCAACT	203
GADPH	GGTGGTCTCCTCTGACTTCAACA	GTTGCTGTAGCCAAATTCGTTGT	127

Yu M., Wei Y., Zheng Y., Yang L., Meng L., Lin J., Xu P., Mahdy S.A., Zhu L., Peng S., Chen L, & Wang L. (2021). 17β-Estradiol activates Cl− channels via the estrogen receptor α pathway in human thyroid cells. Channels, 15(1), 516-527.

+ Open protocol

+ Expand

Hippocampal RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The hippocampus tissue was taken out from the liquid nitrogen and weighed. The tissue (0.1 g) was grounded to fine powder and 1 mL of Trizol was added (15596026; Invitrogen, Carlsbad, USA). The total RNA was extracted using the single-step method according to the manufacturer's instructions, and the concentration was measured with Eppendorf BioPhotometer (Takara, Kyoto, Japan) before reverse transcription of the total RNAs (1 μg) into cDNAs. In accordance with the manufacturer's protocol, the samples were first treated with 5 Xg DNA eraser buffer, gDNA eraser and total RNA for 2 min at 42°C to erase DNA, and then reversely transcribed into cDNAs (37°C for 15 min and 85°C for 5 s). The real-time quantitative polymerase chain reaction (RT-qPCR) was conducted using SYBR ® Premix Ex Taq TM kit (Tli RNaseH Plus; Takara) and a RT-qPCR device (ABI 7500; Thermo Fisher Scientific, Waltham, USA) with the running parameters were as follows: 95°C for 10 min (pre-denaturation) and 40 PCR cycles (pre-denaturation 95°C for 30 s, denaturation 95°C for 30 s, annealing for 20 s, and extension 72°C for 30 s). miR-21-5p was applied as an internal control for U6, and GAPDH was applied as an internal control for other genes. The primers (GenePharma, Shanghai, China) are listed in Table 1.

Zhang X., Li X., Li B., Sun C, & Zhang P. (2020). miR-21-5p protects hippocampal neurons of epileptic rats via inhibiting STAT3 expression. Advances in clinical and experimental medicine : official organ Wroclaw Medical University, 29(7).

+ Open protocol

+ Expand

Quantitative Analysis of Topoisomerase Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

To extract total RNA, we used TRIzol reagent (15596018; Invitrogen) following the kit guidelines before transcribing it into cDNA utilizing the PrimeScript RT reagent kit (RR037A; Takara). On an Applied Biosystems StepOnePlusTM Real-Time PCR equipment, expression levels were evaluated via Quantitative real-time PCR (qRT-PCR) with the SYBR® Premix Ex TaqTM kit (Tli RNaseH Plus; Takara Biotechnology) as directed by the manufacturer. qRT-PCR primers used were as follows: 5′-GGC ATT CCA AAG AAG ACT ACA ACA CCA-3′ and 5′-TAC TTC TTT CCT AGC CCG ACC GGT-3′ for TOP2β; 5′-CCC CAA CTT TGA TGT GCG TG -3′ and 5′-TCC ATG TTC TGA CGG GAA GC-3′ for TOP2α; 5′-CCG GAT CTT GAT GCT GGT GT-3′ and 5′-ATC ACT CTC CCC TGC CTG AT-3′ for MDM2; 5′-AGG GCA TCC TGG GCT ACA C-3′ and 5′-GCC AAA TTC GTT GTC ATA CCA G-3′ for GAPDH.

Shu J., Jiang J., Wang X., Yang X., Zhao G, & Cai T. (2024). MDM2 provides TOP2 poison resistance by promoting proteolysis of TOP2βcc in a p53-independent manner. Cell Death & Disease, 15(1), 83.

+ Open protocol

+ Expand

Quantitative Analysis of luxI/R Homologs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

qRT-PCR on luxI/R homologs was done as described previously (Lu and Huang, 2018 (link)). Briefly, cells of UT26 and SYK-6 at different growth phases and culture conditions were harvested and their total RNA was extracted with RNAprep pure Cell/Bacteria Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. cDNA was synthesized using FastKing gDNA Dispelling RT SuperMix (Tiangen Biotech, Beijing, China) and was used as the template for qRT-PCR amplification by using SYBR Premix Ex TaqTM Kit (Tli RNaseH Plus) (TaKaRa, Dalian, China) in Applied Biosystems StepOnePlus TM Real-Time PCR System (Thermo Scientific, Waltham, MA, United States). Primers were designed on the Sangon website¹ and listed in Supplementary Table S2. The relative gene expression level of the mutant to the wild-type strain was analyzed using the 2^−∆∆Ct analysis method (Lu and Huang, 2018 (link)).

Xiao Y., Chen X., Lu H., Jiang T., Wang Y., Liang L., Dobretsov S, & Huang Y. (2024). Regulation of quorum sensing activities by the stringent response gene rsh in sphingomonads is species-specific and culture condition dependent. Frontiers in Microbiology, 15, 1368499.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used Trizol (Takara) to extract RNA from cells. cDNA synthesis was conducted by PrimeScript^TM RT Master Mix kit (Takara). PCR reaction was then done with SYBR Premix Ex Taq^TM, (Tli RNaseH Plus) kit (Takara). The primers used in this paper were shown in Table S2. GAPDH was used as a control gene.

Hu X., Jiang J., Ni C., Xu Q., Ye S., Wu J., Ge F., Han Y., Mo Y., Huang D, & Yang L. (2019). HBV Integration-mediated Cell Apoptosis in HepG2.2.15. Journal of Cancer, 10(17), 4142-4150.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells and tissues with TRIzol reagents (Invitrogen Inc., Carlsbad, CA, USA). Following concentration determination, the RNA was reversely transcribed into complementary DNA (cDNA) utilizing PrimeScript™ RT reagent kit with gDNA Eraser kit (RRO37A, TaKaRa, Japan; for mRNA detection) and polyA tailing reverse transcription kit (B532451, Shanghai Sangon biotech company) (for miR-30b detection). RT-qPCR was processed utilizing SYBR Premix Ex TaqTM (Tli RNaseH Plus) kit (RR820A, TaKaRa) on an ABI 7500 instrument (Thermo Fisher Scientific). mRNAs were normalized to GAPDH while miR-30b to U6, respectively. The primer sequences are shown in Additional file 1: Table S1. The fold changes were calculated employing relative quantification (the 2^−ΔΔCt method).

Wang P., Li C., Deng Y., Yu Q., Meng X., Jiang T., Wang Q, & Fu Y. (2022). Effect of plasma-derived extracellular vesicles on angiogenesis and the ensuing proliferative diabetic retinopathy through a miR-30b-dependent mechanism. Diabetology & Metabolic Syndrome, 14, 188.

+ Open protocol

+ Expand

Quantification of Gene and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissues or cells collected 24 h after transfection by TRIZOL (Invitrogen). GR, miR-143-3p, JAG1 and NOTCH2 primers were designed and further synthesized by Invitrogen. Different reverse transcription (RT) kits, TaqMan

^{TM}

MicroRNA Reverse Transcription Kit (4366596, Thermo Fisher Scientific, Rockford, IL, USA) and High-Capacity cDNA Reverse Transcription Kit (4368813, Thermo Fisher Scientific), were employed to reversely transcribe the obtained total RNA into cDNA. Real time quantitative polymerase chain reaction (qPCR) experiments were performed on ABI7500 qPCR instrument (Thermo Fisher Scientific) using the SYBR

^{®}

Premix Ex TaqTM (Tli RNaseH Plus) kit (RR820A, TaKaRa, Japan) with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 regarded as the internal reference (Invitrogen). The primers used are listed in Table 1. PCR was performed on a real-time fluorescence qPCR instrument (ABI, Foster City, CA, USA). The final data obtained were analyzed using the 2

^{- Δ Δ Ct}

method.

Zhang L., Jiang H., Zhang Y., Wang C., Xia X, & Sun Y. (2020). GR silencing impedes the progression of castration-resistant prostate cancer through the JAG1/NOTCH2 pathway via up-regulation of microRNA-143-3p. Cancer Biomarkers, 28(4), 483-497.

+ Open protocol

+ Expand

RNA Isolation and RT-qPCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from transfected HUVECs using TRIZOL (Invitrogen Inc.). The primers were designed and synthesized by Invitrogen Inc. (Table 2). The cDNA was then synthesized following instructions in the manuals provided by the TaqMan™ MicroRNA Reverse Transcription Kit (4366596, Thermo Fisher Scientific Inc., Waltham, MA, USA) and High-Capacity cDNA Reverse Transcription Kit (4368813, Thermo Fisher Scientific Inc.). RT-qPCR was conducted using the SYBR®Premix Ex TaqTM (Tli RNaseH Plus) Kit (RR820A, Takara Bio Inc., Tokyo, Japan) on the ABI7500 quantitative PCR instrument (Thermo Fisher Scientific Inc.). The relative expression level of mRNA or miR was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 expression and was calculated using the 2^-ΔΔCt method [36 (link)].

Cheng X., Liu T., Ma L., Liu Z., Xin Y., Jia Z., Chen Y., Li C, & Sun R. (2020). Prothrombotic effects of high uric acid in mice via activation of MEF2C-dependent NF-κB pathway by upregulating let-7c. Aging (Albany NY), 12(18), 17976-17989.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!