Total genomic DNA was extracted by the Fungal DNA Mini Kit (OMEGA, United States) and then diluted to 10 ng/μL as a working concentration. The primers ITS 4 and ITS 5 were used for amplification of ITS sequences. The PCR mixtures contained 1 × PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.4 μM of each primer, 1.25 U of Taq polymerase, and 1 μL DNA template in a total volume of 25 μL. PCR was performed with an Eppendorf Mastercycler thermal cycler (Eppendorf Inc., Germany) as follows: initial denaturation at 94°C for 4 min, followed by 30 cycles of 94°C for 30 s, 54°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 8 min. Amplified PCR products were detected by gel electrophoresis on a 1% agarose gel and then sent to Tsingke Biological Technology (China) for sequencing.
Mastercycler thermal cycler
Manufactured by Eppendorf
Sourced in Germany, Japan
The Mastercycler thermal cycler is a laboratory instrument used for the amplification and analysis of DNA samples. It is designed to precisely control the temperature and duration of the various stages involved in the polymerase chain reaction (PCR) process, which is a fundamental technique in molecular biology and genetics. The Mastercycler provides the necessary temperature cycling capabilities to facilitate the DNA replication and analysis required for a wide range of applications.
Automatically generated - may contain errors
Lab products found in correlation
Pierce agarose chip kit, by Thermo Fisher Scientific (4 mentions)
Myiq single color real time pcr detection system, by Bio-Rad (2 mentions)
Sybr green reagent, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Revertra ace qpcr rt kit, by Toyobo (2 mentions)
Lightcycler, by Roche (2 mentions)
7500 fast real time pcr detection system, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Ezup column fungi genomic dna purification kit, by Sangon (1 mentions)
Taq polymerase, by Sangon (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Pcr master mix, by Promega (1 mentions)
Wizard sv gel and pcr clean up system, by Promega (1 mentions)
Gotaq 2 step rt qpcr system, by Promega (1 mentions)
Dneasy powersoil pro kit, by Qiagen (1 mentions)
Nextera xt index kit, by Illumina (1 mentions)
Fragment analyzer system, by Agilent Technologies (1 mentions)
Miseq platform, by Illumina (1 mentions)
Dnaase, by Thermo Fisher Scientific (1 mentions)
33 protocols using mastercycler thermal cycler
1
Fungal Genomic DNA Extraction and ITS Amplification
2
Fungal DNA Extraction and Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was extracted by a Fungal DNA Mini Kit (Omega, USA). ITS 4 and ITS 5 (White et al. 1990 (link)), LROR and LR5/LR7 (Vilgalys and Hester 1990 (link)), were used for amplification of internal transcribed spacer (ITS ), nuclear ribosomal large subunit (nrLSU ), respectively. Each PCR mixture contained 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.4 μM of each primer, 1.25 U of Taq polymerase, and 1–2 μl DNA template in a total volume of 25 μl. PCRs were performed with an Eppendorf Mastercycler thermal cycler (Eppendorf Inc., Germany) as follows: initial denaturation at 94 °C for 4 min (ITS ; nrLSU ; tef1-α); followed by 30–35 cycles of 94 °C for 30 s (ITS ; nrLSU ), 54 °C for 30 s (ITS ) or 55 °C for 1 min (nrLSU ), and 72 °C for 30 s (ITS ), 1 min (nrLSU ); and a final extension at 72 °C for 7–10 min. Amplified PCR products were detected by gel electrophoresis on 2% agarose gels and then sent to Tsingke Biological Technology (China) for sequencing.
3
Fungal DNA Extraction and Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was extracted from the dried samples using the Ezup Column Fungi Genomic DNA Purification Kit (Sangon Biotech, Shanghai, China) in accordance with the manufacturer’s instructions. The primer pair ITS4/ITS5 [10 (link)] was used to amplify the internal transcribed spacer (ITS) region, and the universal primers LR0R, LR3, and LR5 [11 (link),12 (link)] were used to amplify the nuclear ribosomal large subunit (nrLSU) region. Each PCR amplification was performed with an Eppendorf Mastercycler thermal cycler (Eppendorf Inc., Hamburg, Germany) in a 25 μL reaction mixture, which contained 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.4 μM of each primer, 1.25 U Taq polymerase (Sangon Biotech, Shanghai, China), and 1 μL DNA template. The thermal cycling was performed as follows: initial denaturation at 94 °C for 4 min, then 34 cycles of 94 °C for 40 s, annealing at 55 °C for 40 s, extension at 72 °C for 1 min, and a final extension at 72 °C for 8 min [13 (link)]. All amplified PCR products were electrophoresed on 1% agarose gel, and the purified PCR products were sequenced by Sangon Biotech (Shanghai, China). The specified primers were also used for sequencing reactions. All sequences newly generated in this study were submitted to GenBank.
4
Fungal DNA Extraction and ITS Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 10 mg of each dried sample was weighed. Total genomic DNA was extracted with the Fungal DNA Mini kit (Omega, USA). Internal transcribed spacers (ITSs) 4 and 5 were used to amplify ITS sequences. Each polymerase chain reaction (PCR) mixture contained 1 × PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.4 μM of each primer, 1.25 U of Taq polymerase, and 1 μl DNA template in a total volume of 25 μl. PCRs were run on an Eppendorf Mastercycler thermal cycler (Eppendorf, Inc., Germany) as follows: initial denaturation at 94°C for 4 min; followed by 30 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 8 min. Amplified PCR products were detected using gel electrophoresis on 1% agarose gels and then sequenced at Tsingke Biological Technology (China).
5
Comprehensive Molecular Techniques Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All chemicals were purchased from Fisher Scientific (Ottawa, ON, Canada) unless otherwise specified. Polymerase chain reactions (PCR) were conducted in an Eppendorf Mastercycler thermal cycler (Eppendorf, Hamburg, Germany) using the PCR master mix from Promega (Madison, WI, USA). Quantitative PCR (qPCR) assays were conducted in a StepOnePlus Real-Time PCR System (Life Technologies, Carlsbad, CA, USA) using the GoTaq 2-Step RT-qPCR System (Promega) or the Power SYBR Green PCR master mix (Life Technologies). qPCR primers were designed with the online program Primer3web (http://primer3.ut.ee ). DNA purification of amplicons from the reaction mixture or agarose gel was performed using a Wizard SV Gel and PCR Clean-Up System (Promega). Similarity searches of nucleic acid and protein sequences were performed using the Basic Local Alignment Search Tool (BLAST) against the National Center for Biotechnology Information (NCBI) database unless otherwise specified. Sequencing was done by the Department of Biological Sciences, University of Alberta (Edmonton, AB, Canada). Other molecular techniques, if not specified, were performed according to the protocols described by Sambrook and Russell [43] .
6
16S rRNA Amplicon Sequencing of Microbiome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Community DNA extraction from pooled fecal, manure pack, and Day 84 samples was performed using the QIAGEN DNeasy® PowerSoil® Pro kit (Qiagen, Valencia, CA) per the manufacturer’s protocol within the automated QIAcube robot. Library preparation was conducted using Nextera XT Index Kits (Illumina, Inc., San Diego, CA) and Mastercycler® Thermal Cycler (Eppendorf, Enfield, CT). Amplicon primers 341F (5’-CCTACGGGNGGCWGCAG-3’) and 785R (5′-GACTACHVGGGTATCTA ATCC-3′) with index adapters were utilized to specifically target and amplify the hypervariable V3/V4 region of the bacterial 16S rRNA gene (Klindworth et al., 2013 (link)). Library validation was performed on the Fragment Analyzer System (Agilent Technologies, Inc., Santa Clara, CA) prior to paired-end amplicon sequencing (2 × 300) of the 16S rRNA gene using MiSeq reagent v3 kits and the Illumina MiSeq platform (Illumina, Inc.) per manufacturer’s protocol. The 16S rRNA amplicon sequence data can be found in the NCBI database under BioProject accession number: PRJNA595617 .
7
Robust cDNA Synthesis from Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA synthesis was performed in a Mastercycler thermal cycler (Eppendorf), using 2 μg of total RNA from each sample. Before the reverse transcription process, 2 μg of total RNA was treated with DNAase (Thermo Fisher Scientific) at 37°C for 30 min to eliminate any possible DNA contamination. For a final volume of 20 μL, the above mixture was incubated with 2.5 mM EDTA for 10 min at 65°C followed by incubation with 0.5 μg Oligo-dT and denatured at 70°C for 5 min. Subsequently, the transcription buffer (50 mM Tris-HCl, pH 8.3, 50 mM KCl, 4 mM MgCl2, 10 mM DTT), dNTPs (1 mM each) and 20 U of the RNA inhibitor or Ribolock (Thermo Fisher Scientific) were added, incubating for 5 min at 37°C. Then, 200 U of RevertAid® H Minus M-MuLV (Thermo Fisher Scientific) reverse transcriptase was added to this mixture and incubated for 1 h at 42°C, followed by 70°C for 10 min to stop the reaction. As a negative control, parallel reactions were performed in the absence of oligo-dT and reverse transcriptase enzyme (RT) to detect the presence of contaminating DNA.
8
ChIP Analysis of Transcription Factor Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis was performed using a PierceTM Agarose ChIP Kit (Thermo Scientific, Rockford, IL). Sheared chromatin was diluted and immunoprecipitated with 2 μg of anti-STAT3, anti-TCF4 or control IgG antibody. DNA protein complexes were eluted from protein A/G agarose beads using a spin column and were reverse cross-linked by incubating with NaCl at 65 °C. The relative TCF4 binding to the c-MYC and uPAR promoters or STAT3 binding to miR-21 promoter was analyzed by MyiQ™ Single-Color Real-Time PCR Detection System (Bio-Rad, Hercules, CA) with SYBR Green PCR master mix using following primer sequences, STAT3 binding to miR-21 promoter/enhancer (F) CCTCTGAGAAGAGGGGACAA and (R) ACCGCTTCCAGCAAAAGAGT. General PCR amplification also performed in a Mastercycler thermal cycler (Eppendorf, Foster City, CA).
9
PCR Amplification of Bacterial DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplifications were performed from total bacterial DNA obtained using the InstaGene matrix (Bio-Rad laboratories Inc., Hercules, CA, USA) in 25 or 50 μl reaction mixtures containing MyTaq mix buffer (Bioline Reagents Ltd., London, UK), 0.7 μM of each primer and 1 μl of purified DNA. Oligonucleotide primers were obtained from Sigma Genosys Ltd. (Cambridge, UK). Samples were subjected to PCR amplification in an Eppendorf Mastercycler thermal cycler (Eppendorf, Hamburg, Germany). When needed, the resulting PCR fragments were purified using the NucleoSpin Extract II kit (Macherey-Nagel, Düren, Germany) and sequenced at the Unidad de Genómica (Parque Científico de Madrid, Facultad de Ciencias Biológicas, Universidad Complutense de Madrid, Spain).
10
Species-Specific PCR Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Species specific PCR assay was carried out by using the species specific primers as described by Prashant et al.56 (link) (Table 3 ). The PCR amplification was performed in 20 μL reaction which contained 2 μL of 10× PCR buffer, 2 mM MgCl2, 100 μM dNTPs, 1 unit of Taq polymerase (MBI Fermentas, India) and 20 ηg of template DNA in a Mastercycler thermal cycler (Eppendorf, Hamburg, Germany). The PCR programme consisted of initial denaturation at 94 °C for 4 min followed by 30 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min and extension at 72 °C for 2 min, and final extension at 72 °C for 10 min. PCR amplicons were resolved on 1% agarose gel and visualized in a UV transilluminator. A 1 kb ladder was used as a marker. Gels were documented using Gbox (GE health care, Mumbai).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!