Smifh2

HeLa cells and Caco2 monolayers were treated with 50 µM CK666 + 50 µM CK869 (Calbiochem), 25 µM SMIFH2 (Tocris), 4 µM Wiskostatin (Sigma), or equivalent volumes of DMSO for 15 min prior to infection. During infections, media containing bacteria and inhibitors were added to HeLa cells and Caco2 monolayers, and the latter cells were washed with PBS and given fresh inhibitor-containing media every hour during the course of infection. NIH3T3 cells expressing mCherry-βactin [97 (link)] were infected 3.5–4.0 h prior to treatment with inhibitors, and live imaging was completed 15–120 min after the addition of the inhibitors.
RNA and DNA transfections were performed using RNAiMAX or Lippofectamine-LTX reagents (Invitrogen). To clone GFP-mDia1, mDia1 plasmid DNA (variant BC143413, Dharmacon) was PCR amplified as a Kpn1-Not1 fragment using primers ATCATCGGTACCATGGAGCCGCCCGGCGGGAG, and ATCATCGCGGCCGCTTATTAGCTTGCACGGCCAACCAACTC and ligated into the vector pKC-EGFP-C1 [97 (link)]. The plasmid was maintained in E. coli XL-1 Blue. For transient expression, 100 ng of GFP-mDia1 plasmid was transfected in 6-well plates. Sigma MISSION siRNAs (see S2 Table) were used at 40 nM for RNAi experiments. Targets were selected based on HeLa cell expression data cataloged on the Human Protein Atlas (https://www.proteinatlas.org/cell).

Alexa 647 (A647; 20–30 μM in bathing solution, Invitrogen) and Alexa 488 dyes (A488; 20–30 μM in bathing solution, Invitrogen) were excited by a solid-state 638 nm (30 mW output) and 488 nm lasers (20 mW output) with an inverted confocal microscope (TCS SP8, Leica, Germany; original magnification, × 63/1.40 oil objective). Unless mentioned otherwise, the 638 nm laser was set at 20–25% of the maximum power and the 488 nm laser was set at 0.5–2% of the maximum power. A647 fluorescence was collected with a photomultiplier at 639–767 nm, whereas A488 was collected with a hybrid GaAsP spectral detector at 489–596 nm. For time-lapse A647/A488 imaging, images were collected with 40 ms inter-frame interval at 45–70 nm per pixel in an imaging area of ∼160–320 μm². In some experiments, cells were pre-treated with 3 μM latrunculin A (Enzo Life Sciences), 4 μM Cyto D (Enzo Life Sciences), wiskostatin (10 μM, Tocris Bioscience) and SMIFH2 (25 μM, Tocris Bioscience) for 20 min in the bath solution, or whole-cell dialysis of phalloidin–FITC (1.3 μM, Invitrogen) for 2–3 min before imaging.

For drug treatments, oocytes were transferred into plastic dishes (Ibidi #80131). To inhibit myosin II ATPase activity, oocytes were incubated with a final concentration of 300 µM Blebbistatin (Abcam) for at least 3 hr before starting maturation; with ML-7 (Tocris) and Y-27632 (Enzo Life Sciences) at a final concentration of 100 µM for 1 hr. To induce acute F-actin depolymerization, oocytes were first matured and then treated with Latrunculin A (Abcam) after NEBD, as NEBD is known to depend on actin polymerization in starfish oocytes (Mori et al., 2014 (link)). To inhibit formin FH2 activity, we incubated oocytes with SMIFH2 (Tocris) at a final concentration of 50 µM for at least 2 hr.

U0126 (cat #: 9903), Dactolisib (NVP-BEZ235; cat #: 13101), and Perifosine (cat #: 14240) were purchased from Cell Signaling Technology (Beverly, MA). Dasatinib (cat #: S1021), Saracatinib (cat #: S1006), and Defactinib (cat #: S7654) were purchased from Selleckchem (Houston, TX). CK-666 (cat #: 3950) and SMIFH2 (cat #: 4401) were purchased from Tocris Bioscience (Bristol, UK). To inhibit a pathway, a 1000× stock solution in dimethyl sulfoxide (DMSO; Sigma-Aldrich, St. Louis, MO) was diluted in 400 µL media and dissolved using a vortex mixer for 30 s before adding to wells containing 2 mL of media. For AFM analyses, cells were treated for 30 min prior. Treatments for fluorescence microscopy are as noted in each figure.