Ni ted resin

Recombinant proteins were expressed in E. coli BL21(DE3) and purified by affinity chromatography using amylose resin (New England Biolabs). Recombinant His‐UBA1 and His‐UBC8 were purified using Ni‐Ted resin (Macherey‐Nagel). Purified proteins were used for in vitro ubiquitination assays. Each reaction of 30 ml final volume contained 25 mM Tris–HCl, pH 7.5, 5 mM MgCl₂, 50 mM KCl, 2 mM ATP, 0.6 mM DTT, 2 μg ubiquitin, 200 ng E1 His‐ AtUBA1, 1.2 μg E2 His‐AtUBC8, 2 μg of E3s, and 0.3 µg of MBP‐AtSH3P2. Samples were incubated for 1 h at 30°C, and the reaction was stopped by adding SDS loading buffer and incubated for 10 min at 68°C. Samples were separated by SDS–PAGE electrophoresis using 4–15% Mini‐PROTEAN^® TGX™ Precast Protein Gels (BioRad) followed by detection of the ubiquitinated substrate by immunoblotting using anti‐MBP (New England Biolabs), anti‐GST and anti‐ubiquitin (Santa Cruz Biotechnology) antibodies.

The p17 constructs were expressed in BL21(DE3)pLys competent cells (Lucigen). Lysogeny broth (250 ml) supplemented with 25 µg/ml ampicillin were seeded with an overnight preculture and incubated at 37°C with agitation. When OD_600nm ≈ 0.4, protein expression was induced with 2 mM isopropyl-β-d-1-thiogalactopyranoside (Euromedex) and incubated for 5 h at 37°C. Cultures were then centrifuged at 6,000 × g for 5 min, and pellets were stored overnight at −20°C.
Bacterial lysis and protein purification using Ni-TED resin (Macherey-Nagel) were performed as previously described (31 (link)), except lysis was performed by sonication of the pellet for4× 1 min/g with a Sonifier 250 sonicator (Brandson).
Following protein purity analysis with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), elution fractions were pooled, dialyzed against 50 mM 2-(N-morpholino)ethanesulfonic acid (MES), pH 6, overnight at 4°C, and concentrated to 1 mg/ml according to the absorbance of the protein solution at 280 nm, using a Vivaspin-PES 10 kDa (Sartorius).
Circular dichroism spectra were recorded and processed using a Chirascan Dichrometer (Applied Photophysics) as described previously (32 (link)), with 150 µl of protein at 0.2 mg/ml in 50 mM MES pH 6.

The N-terminus of Ine varies in both long (P1) and short (P2) isoforms. To generate a specific antiserum against the long Ine-P1 isoform we amplified the Ine-P1 specific N-terminal sequence using PCR and the following primers (including underlined EcoRI and HindIII sites respectively): GGATCCATATGGCGGAGAACAAAGACG and AAGCTTTGGTGGCGTCTGCGGATTG using a cDNA clone (HL05815, BDGP Berkeley, USA). The amplicon was subcloned into pGEMT Easy (Promega GmbH, Mannheim, Germany) and further cloned into the pQE 82L expression vector, which allows the generation of N-terminal His-tagged proteins (Qiagen GmbH, Hilden, Germany). The approximate 32.4 kDa N-terminal region of Ine-P1 was expressed in E.coli, affinity purified with Ni-TED resin (Macherey-Nagel GmbH, Düren, Germany), and injected into guinea pig (Eurogentec S.A., Seraing, Liège, Belgium). A second antibody to Ine-P1 was raised in rabbit using an HPLC-purified peptide H₂N-MPNRQDYDAQSSKHS+ C-CONH_2, coupled to KLH.