The largest database of trusted experimental protocols

Mccoy s 5a medium

Manufactured by iCell Bioscience
Sourced in China

McCoy's 5A Medium is a cell culture medium formulated to support the growth and maintenance of various cell types, including human and animal cells. It provides the necessary nutrients and components for cell proliferation and survival in in vitro cell culture applications.

Automatically generated - may contain errors

6 protocols using mccoy s 5a medium

1

TGF-β1 Induction of T24 Bladder Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human bladder cancer cell line T24 used in this research was purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China) and cultured in McCoy’s 5A medium (iCell, China) containing 10% fetal bovine serum (FBS, BI, ISR). The cells were grown at 37 °C and 5% CO2. The human TGF beta 1 (TGF-β1) protein was purchased from MedChemExpress (HY-P7118). T24 cells were treated with TGF-β1 (10 ng/ml) for 48 h.
+ Open protocol
+ Expand
2

Culturing Human Colon Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human normal colon epithelium cell lines (NCM460) and human colorectal cancer cell lines (SW480 and HCT116) were bought from the American Type Culture Collection (ATCC, USA). Human colorectal cancer cell lines (HT29 and RKO) were purchased from the iCell (Shanghai, China). SW480 was grown in Dulbecco's modified Eagle's medium (DMEM) (GIBCO, USA). NCM460 and LOVO were grown in RPMI (1640) medium (GIBCO, USA). RKO was grown in modified Eagle's medium (MEM) (GIBCO, USA). HT29 was grown in McCOY's 5A medium (iCell, China). All cells were cultured in a constant temperature and humidified incubator at 37°C with 5% CO2.
+ Open protocol
+ Expand
3

Quantifying Renal Cell Carcinoma FRGs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human renal cortex proximal tubule epithelial cells (HK-2 cells) were cultured in DMEM/F12 medium (Gibco, USA), the human primary clear cell adenocarcinoma cells (7860 cells) and the human skin metastasis-derived clear cell renal cell carcinoma cells (Caki-1 cells) were maintained in RPMI 1640 medium (Gibco, USA) and McCoy’s 5A Medium (iCell, China), respectively. All mediums were supplemented with 10% fetal bovine serum (Gibco, USA), 100 U/mL of penicillin and 100 U/mL of streptomycin (Gibco, USA). The conditions of cell cultures were 37°C and 5% CO2.
Using the FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, China) to extract the total RNA following the manufacturer’s instructions. Then, the HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, China) was used to perform the reverse transcription reactions and the AceQ Universal SYBR qPCR Master Mix (Vazyme, China) was used to complete qPCR.
The comparative Ct method was used to analyze the relative expression levels of four FRGs: 2−ΔΔCt (ΔΔCt = (ΔCt of FRG) − (ΔCt of GAPDH). GAPDH was used as the internal normalized reference to FRGs. The specific primer sequences used were listed in Table 1.
+ Open protocol
+ Expand
4

Cell Line Cultivation Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
The normal human intestinal epithelial cell line (NCM460) and human colonic carcinoma cell lines (HCT116, HT29, HCT15, and LOVO) were purchased from the Culture Collection of Chinese Academy of Sciences (Shanghai, China). In short, the HCT116 and HT29 cell lines were maintained in McCoy’s 5A medium (iCell, China). NCM460 was maintained in DMEM (Gibco, USA), and HCT15 was maintained in RPMI 1640 medium (Gibco). LOVO was maintained in the F12k medium (iCell, China). All media were supplemented with 10% fetal bovine serum (Gibco), supplemented with 1% penicillin and streptomycin (Gibco). All cell lines were cultured in a humidified incubator containing 5% CO2 at 37°C.
+ Open protocol
+ Expand
5

RT-qPCR Analysis of STEAP3 in Renal Cell Carcinoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
All cells were purchased from the American Type Culture Collection (ATCC). The human renal cortex proximal tubule epithelial cells (HK-2 cells) were maintained in DMEM/F12 medium (Gibco, USA), the human skin metastasis-derived clear cell renal cell carcinoma cells (Caki-1) and the human primary clear cell adenocarcinoma cells (786O cells) were cultured in McCoy’s 5A Medium (iCell, China) and RPMI 1640 medium (Gibco, USA), respectively. All mediums were supplemented with 10% fetal bovine serum (Gibco, USA), and cells were cultured at 37 °C and 5% CO2.
The Total RNA Isolation Kit (Vazyme, China) was used to isolate the total RNA according to the manufacturer’s instructions. Using the HiScript III RT SuperMix for qPCR (+ gDNA wiper) (Vazyme, China) to conduct the reverse transcription and the qPCR were accomplished by the AceQ Universal SYBR qPCR Master Mix (Vazyme, China). The comparative Ct method was used for evaluating the relative expression levels of STEAP3. Primer sequences of STEAP3 and GAPDH for RT-qPCR was shown in Table 2.

Primer sequences of STEAP3 and GAPDH for RT-qPCR

GeneSequence (5’- 3’)
STEAP3FaCCAATGCTGAGTACCTGGC
RaATCTCCGAGACAGCACGC
GAPDHFGCCTTCCGTGTCCCCACTGC
RGGCTGGTGGTCCAGGGGTCT

aF forward, R reverse

+ Open protocol
+ Expand
6

Culturing Bladder Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human bladder cancer cell line J82 cells were cultured in MEM Alpha Medium (Gibco, USA). The RT4 cells and T24 cells were maintained in McCoy’s 5A Medium (iCell, China), and the 5637 cells were cultured in RPMI1640 Medium (iCell, China). The UMUC3 cells and TCCSUP cells were cultured in MEM (iCell, China), and the SW780 cells were maintained in L15 Medium (iCell, China). The human urothelial cells line SV-HUC-1 cells were cultured in F12K medium (iCell, China). All of the mediums were supplemented with 10% fetal bovine serum (FBS, BI, ISR), 100 μg/mL of penicillin, and 100 U/mL of streptomycin (Invitrogen). All of the examined cells were grown at 37°C with 5% CO2.
The SCD inhibitor (A939572) utilized in this study was purchased from MedChem Express (HY-50709).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!