Mccoy s 5a medium
McCoy's 5A Medium is a cell culture medium formulated to support the growth and maintenance of various cell types, including human and animal cells. It provides the necessary nutrients and components for cell proliferation and survival in in vitro cell culture applications.
Lab products found in correlation
6 protocols using mccoy s 5a medium
TGF-β1 Induction of T24 Bladder Cancer Cells
Culturing Human Colon Cell Lines
Quantifying Renal Cell Carcinoma FRGs
Using the FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, China) to extract the total RNA following the manufacturer’s instructions. Then, the HiScript III RT SuperMix for qPCR (+gDNA wiper) (Vazyme, China) was used to perform the reverse transcription reactions and the AceQ Universal SYBR qPCR Master Mix (Vazyme, China) was used to complete qPCR.
The comparative Ct method was used to analyze the relative expression levels of four FRGs: 2−ΔΔCt (ΔΔCt = (ΔCt of FRG) − (ΔCt of GAPDH). GAPDH was used as the internal normalized reference to FRGs. The specific primer sequences used were listed in
Cell Line Cultivation Protocols
RT-qPCR Analysis of STEAP3 in Renal Cell Carcinoma
The Total RNA Isolation Kit (Vazyme, China) was used to isolate the total RNA according to the manufacturer’s instructions. Using the HiScript III RT SuperMix for qPCR (+ gDNA wiper) (Vazyme, China) to conduct the reverse transcription and the qPCR were accomplished by the AceQ Universal SYBR qPCR Master Mix (Vazyme, China). The comparative Ct method was used for evaluating the relative expression levels of STEAP3. Primer sequences of STEAP3 and GAPDH for RT-qPCR was shown in Table
Primer sequences of STEAP3 and GAPDH for RT-qPCR
Gene | Sequence (5’- 3’) | |
---|---|---|
STEAP3 | Fa | CCAATGCTGAGTACCTGGC |
Ra | ATCTCCGAGACAGCACGC | |
GAPDH | F | GCCTTCCGTGTCCCCACTGC |
R | GGCTGGTGGTCCAGGGGTCT |
aF forward, R reverse
Culturing Bladder Cancer Cell Lines
The SCD inhibitor (A939572) utilized in this study was purchased from MedChem Express (HY-50709).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!