Log In Sign up
The largest database of trusted experimental protocols

3xap1pgl3

Manufactured by Promega
Visit Supplier

The 3XAP1pGL3 is a plasmid designed for use in luciferase reporter gene assays. It contains three copies of the AP1 transcriptional response element upstream of the firefly luciferase gene.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (6 mentions) Calcium phosphate, by Promega (3 mentions) Bp reaction, by Thermo Fisher Scientific (3 mentions) Lr cloning, by Thermo Fisher Scientific (3 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Pdonr221, by Thermo Fisher Scientific (1 mentions) Smartpool sirna, by Horizon Discovery (1 mentions)

3 protocols using 3xap1pgl3

1

Cloning and Validation of TRIM5 Constructs

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
pDest40-APEX2-V5 and pLEX_307-APEX2-V5; pDest40-RhTRIM5-APEX2-V5 and pLEX_307- RhTRIM5-APEX2-V5; pDest40-HuTRIM5-APEX2-V5 and pLEX_307-HuTRIM5-APEX2-V5; LIR2 mutant pDest40-GFP-RhTRIM5 were generated using Gateway recombination cloning. First, they were PCR amplified from available cDNA clones and recombined into pDONR221 using the BP reaction (Life Technologies, 11789–020) prior to being recombined into expression plasmids by LR cloning (Life Technologies, 11791–020). Plasmid constructs were verified by DNA sequencing. The AP1 luciferase reporter plasmid was a gift from Alexander Dent (Addgene plasmid #40342; 3XAP1pGL3), the NF-κB luciferase reporter was purchased from Promega (#E8491) and the Renilla luciferase plasmid (pRL-SV40, Addgene plasmid #27163) was a gift from Ron Prywes. All other plasmids have been previously published [16 (link),32 (link)]. All siRNA smart pools were from Dharmacon. siRNA was delivered to cells using Lipofectamine RNAiMAX (ThermoFisher, 13778150). Plasmid transfections were performed using Lipofectamine 2000 (ThermoFisher, 11668019) or Calcium Phosphate (Promega, E1200). Samples were prepared for analysis the day after DNA transfection. For siRNA experiments, cells were harvested 48–72h after siRNA transfection.
Saha B., Chisholm D., Kell A.M, & Mandell M.A. (2020). A non-canonical role for the autophagy machinery in anti-retroviral signaling mediated by TRIM5α. PLoS Pathogens, 16(10), e1009017.
+ Open protocol
+ Expand
2

Generating TRIM5-APEX2 Fusion Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
pDest40-APEX2-V5 and pLEX_307-APEX2-V5; pDest40-RhTRIM5-APEX2-V5 and pLEX_307- RhTRIM5-APEX2-V5; pDest40-HuTRIM5-APEX2-V5 and pLEX_307-HuTRIM5-APEX2-V5 were generated using Gateway recombination cloning. First, they were PCR amplified from available cDNA clones and recombined into pDONR221 using the BP reaction (Life Technologies, 11789–020) prior to being recombined into expression plasmids by LR cloning (Life Technologies, 11791–020). Plasmid constructs were verified by DNA sequencing. The AP1 luciferase reporter plasmid was a gift from Alexander Dent (Addgene plasmid #40342; 3XAP1pGL3), the NF-κB luciferase reporter was purchased from Promega (#E8491) and the Renilla luciferase plasmid (pRL-SV40, Addgene plasmid #27163) was a gift from Ron Prywes. GFP-TRIM5 was mutated using site directed mutagenesis kit using following primers to generate GFP-TRIM5E11R: Fw, GGGGCAGGTCACCTCCCGCTTTACATTAACCAGGATTC; Rw, GAATCCTGGTTAATGTAAAGCGGGAGGTGACCTGCCCC.Plasmid transfections were performed using Lipofectamine 2000 (ThermoFisher, 11668019) or Calcium Phosphate (Promega, E1200). Samples were prepared for analysis the day after DNA transfection.
Saha B., Salemi M., Williams G.L., Oh S., Paffett M.L., Phinney B, & Mandell M.A. (2022). Interactomic analysis reveals a homeostatic role for the HIV restriction factor TRIM5α in mitophagy. Cell reports, 39(6), 110797.
+ Open protocol
+ Expand
3

Generating TRIM5-APEX2 Fusion Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
pDest40-APEX2-V5 and pLEX_307-APEX2-V5; pDest40-RhTRIM5-APEX2-V5 and pLEX_307- RhTRIM5-APEX2-V5; pDest40-HuTRIM5-APEX2-V5 and pLEX_307-HuTRIM5-APEX2-V5 were generated using Gateway recombination cloning. First, they were PCR amplified from available cDNA clones and recombined into pDONR221 using the BP reaction (Life Technologies, 11789–020) prior to being recombined into expression plasmids by LR cloning (Life Technologies, 11791–020). Plasmid constructs were verified by DNA sequencing. The AP1 luciferase reporter plasmid was a gift from Alexander Dent (Addgene plasmid #40342; 3XAP1pGL3), the NF-κB luciferase reporter was purchased from Promega (#E8491) and the Renilla luciferase plasmid (pRL-SV40, Addgene plasmid #27163) was a gift from Ron Prywes. GFP-TRIM5 was mutated using site directed mutagenesis kit using following primers to generate GFP-TRIM5E11R: Fw, GGGGCAGGTCACCTCCCGCTTTACATTAACCAGGATTC; Rw, GAATCCTGGTTAATGTAAAGCGGGAGGTGACCTGCCCC.Plasmid transfections were performed using Lipofectamine 2000 (ThermoFisher, 11668019) or Calcium Phosphate (Promega, E1200). Samples were prepared for analysis the day after DNA transfection.
Saha B., Salemi M., Williams G.L., Oh S., Paffett M.L., Phinney B, & Mandell M.A. (2022). Interactomic analysis reveals a homeostatic role for the HIV restriction factor TRIM5α in mitophagy. Cell reports, 39(6), 110797.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!