The cell pellets were collected from different growth phase cultures by spinning them at 13,000×g for 2–3 min at room temperature and the RNA extracted using JetGene RNA Purification Kit (Thermo Fisher Scientific). The cells were lysed with occasional vortexing in a buffer solution with 1× TE buffer, 15 mg/ml lysozyme and 20 mg/ml proteinase K (Promega). The samples were then transferred to a 2-ml Lysing Matrix A tube (MP Biomedicals) with β-mercaptoethanol containing RLT buffer (provided in the kit) for enhanced lysis. The contents in the lysing matrix tubes were then homogenised using the FastPrep™ FP 200 cell disrupter at speed 5.5 for 30 s. A double DNA-digestion treatment was done to ensure that the RNA was free of any genomic DNA (gDNA) contamination. The RNA isolated was quantified using the Nanodrop spectrophotometer with A260/A280 ratio of 1.8–2.1 being considered as pure. The integrity of the samples was checked by agarose gel electrophoresis for presence of two sharp distinct bands representing 23S and 16S rRNA. The integrity was further verified by analysing the samples in an Agilent 2100 Bioanalyzer where RNA Integrity Number (RIN) values greater than 8 were observed for all samples. The RIN is based on a numbering system from 1 to 10 with 1 being the most degraded and 10 being the most intact. The RNA samples were aliquoted and stored at − 80 °C.
Lysing matrix a tube
Manufactured by MP Biomedicals
Sourced in United States, Germany, France
Lysing Matrix A tubes are designed for the mechanical disruption and homogenization of samples. The tubes contain a matrix of beads that help break down samples through physical agitation, enabling efficient release of cellular contents for downstream analysis.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (5 mentions)
Fastprep 24 homogenizer, by MP Biomedicals (5 mentions)
Rnalater, by Thermo Fisher Scientific (4 mentions)
Rnase free dnase set, by Qiagen (4 mentions)
Fastprep 24, by MP Biomedicals (4 mentions)
Fastprep 24 instrument, by MP Biomedicals (4 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Fastprep 24 classic instrument, by MP Biomedicals (3 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (3 mentions)
Trizol, by MP Biomedicals (3 mentions)
Rneasy plus mini kit, by Qiagen (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Qubit rna br assay kit, by Thermo Fisher Scientific (2 mentions)
Qubit rna hs assay kit, by Thermo Fisher Scientific (2 mentions)
2100 bioanalyzer, by Agilent Technologies (2 mentions)
Rnalater solution, by Thermo Fisher Scientific (2 mentions)
Qiazol lysis reagent, by Qiagen (2 mentions)
Microbenrich, by Thermo Fisher Scientific (2 mentions)
Rnalater solution, by Qiagen (2 mentions)
Fastprep 24 sample preparation system, by MP Biomedicals (2 mentions)
47 protocols using lysing matrix a tube
1
High-Quality RNA Extraction and Purification
2
Quantifying Pigment Gene Expression in Skin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To compare the expression of coloration and pigment genes between melanic bars and interbars regions, we sampled the whole melanic and non-melanic skin region. Skin tissue was dissected and kept in RNAlater (Invitrogen) at 4°C overnight and then transferred to −20°C for long-term storage. RNAlater was removed prior to homogenization. Skin samples and the appropriate amount of TRIzol (Invitrogen) (1 ml TRIzol per 100 mg sample) were homogenized in 2 ml Lysing Matrix A tube (MP Biomedicals) using FastPrep-24 Classic Instrument (MP Biomedicals). RNA was extracted according to the manufacturer’s recommendations (Invitrogen) with an additional wash step by 75% Ethanol. Subsequent purification and on-column DNase treatment were performed with the RNeasy Mini Kit (Qiagen) and RNase-Free DNase Set (Qiagen). Following extraction and purification, RNA was quantified using Qubit RNA BR Assay Kit (Invitrogen) with Qubit Fluorometer (Life Technologies).
3
Mouse Skin RNA Extraction and cDNA Synthesis
4
DNA Extraction from Fungal and Plant Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from isolates grown on 2% Malt Extract (Difco) and grown at room temperature for 5–7 days. Approximately 50–100 mg of mycelia was harvested, centrifuged to remove excess liquid and transferred to a sterile 2–mL lysing matrix A tube (MP Biomedical; Solon, OH). The tissues were frozen in liquid nitrogen and homogenized for 10 seconds at 4 m/s using a FastPrep-24 5 G benchtop homogenizer (MP Biomedicals; Solon, OH). Wood samples were similarly treated, frozen in liquid nitrogen, but homogenized twice to pulverize the tissue completely. Conversely, for herbarium samples, homogenization speed and time was reduced to avoid shearing of DNA. DNA of samples of H. irregulare infected red pine tissues from Wisconsin was extracted at the Wisconsin Department of Natural Resources in Fitchburg, WI. DNA was extracted using a modified. CTAB extraction protocol with choloroform and ethanol washes [30 (link)].
5
Transcriptome Analysis of Fish Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fish were obtained from commercial breeders and euthanized with an overdose of MS-222. Experiments were performed in accordance with animal research regulations (Regierungspräsidium Freiburg, Baden Württemberg, Germany, Reference number: G-17/110). Skin, brain (both RNA-seq, cDNA sequencing), liver, eye, and muscle tissue (all cDNA sequencing) were dissected and kept in RNAlater (Invitrogen) at 4 °C overnight and transferred to −20 °C for long-term storage. RNAlater was removed prior to homogenization. Skin samples and appropriate amount of TRIzol (Invitrogen) (1 ml TRIzol per 0.1 g sample) were homogenized in 2 ml lysing matrix A tube (MP Biomedicals) using FastPrep-24 Classic Instrument (MP Biomedicals). RNA was extracted according to the manufacturer’s recommendations with additional 75% ethanol wash one time. Subsequent purification and on-column DNase treatment was performed with RNeasy Mini Kit (Qiagen) and RNase-Free DNase Set (Qiagen). The other organs were extracted using RNeasy Mini Kit (Qiagen). DNA was removed using RNase-Free DNase Set (Qiagen) according to the manufacture’s protocol. Following extraction and purification, RNA was quantified using the Qubit RNA HS Assay Kit (Invitrogen) with a Qubit Fluorometer (Life Technologies). First-strand cDNA was synthesized using 1 μg total RNA and the GoScript Reverse Transcription System (Promega).
6
Extracting Environmental DNA from Water Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted total genomic DNA from water samples following an established procedure (Lu et al., 2016 (link), 2017 (link)). Briefly, we filtered each entire water sample (1 L) with a 0.4 μm pore size polycarbonate membrane to capture microbial cells. The membrane was transferred to a Lysing Matrix A Tube (MP Biomedicals, Santa Ana, California, United States) containing garnet powder and a ceramic sphere. The tube was then stored at −80°C until DNA extraction.
To extract DNA from the stored cells, we added 400 μL of 1× Tissue and Cell Lysis Solution (Epicenter Technologies Corp., Madison, Wisconsin, United States) to each tube. We then shook each tube with a Mini-Beadbeater-16 (BioSpec Products, Inc., Bartlesville, Oklahoma, United States) to lyse the cells. We subsequently centrifuged each tube and recovered total genomic DNA from the supernatant using a MasterPure™ Complete DNA and RNA Purification Kit (Epicenter Technologies Corp., Madison, Wisconsin, United States). A final 100 μL of DNA solution was collected in a microcentrifuge tube for each water sample. We determined the concentration and purity of each DNA sample with a Nanodrop™ 1000 Spectrophotometer (Thermo Scientific, Wilmington, Delaware, United States). The DNA samples were stored at −80°C until use.
To extract DNA from the stored cells, we added 400 μL of 1× Tissue and Cell Lysis Solution (Epicenter Technologies Corp., Madison, Wisconsin, United States) to each tube. We then shook each tube with a Mini-Beadbeater-16 (BioSpec Products, Inc., Bartlesville, Oklahoma, United States) to lyse the cells. We subsequently centrifuged each tube and recovered total genomic DNA from the supernatant using a MasterPure™ Complete DNA and RNA Purification Kit (Epicenter Technologies Corp., Madison, Wisconsin, United States). A final 100 μL of DNA solution was collected in a microcentrifuge tube for each water sample. We determined the concentration and purity of each DNA sample with a Nanodrop™ 1000 Spectrophotometer (Thermo Scientific, Wilmington, Delaware, United States). The DNA samples were stored at −80°C until use.
7
Tumor Lysis and Protein Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each tumor was placed in Lysing Matrix A tube (MP Biomedicals, Irvine, CA, USA) and 0.5 mL of PLB 1X buffer (Promega) was added. The tumor was grinded and lysed by FastPrep-24 machine (MP Biomedicals). The aliquots of the lysates were used to determine the luciferase activity and amount of protein by the Bradford method.
8
Time-course analysis of S. aureus infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both ears of C57BL/6NCrl wild-type mice were intradermally injected with 1 × 107 CFU of non-labeled S. aureus LAC. Three, 6 h, 9 h, 12 h, and 3 days post inoculation, each ear was collected and immersed into 1 ml of RNAlater solution (ThermoFisher Scientific) and stored at 4°C, until ready for processing. Ears were retrieved from the RNAlater solution and cut into small pieces (<0.1 mm2) in the presence of QIAzol Lysis Reagent (Qiagen), transferred into a 2-ml Lysing Matrix A tube (MP Biomedicals) and subsequently homogenized in a FastPrep-24 sample preparation system (MP Biomedicals). Genomic DNA was removed and total RNA extracted using the RNeasy Plus mini kit (Qiagen) according to the manufacturer’s protocol. The genomic DNA-free total RNA samples were treated with MICROBEnrich (Ambion/Life Technologies) to increase the concentration of prokaryotic RNA. RNA quality and concentration were assessed by use of a 2100 Bioanalyzer (Agilent Technologies). Samples were analyzed by qRT-PCR with primers specific for gyrB and psmα (synthesized by Sigma; gyrBFw, CAAATGATCACAGCATTTGGTACAG; gyrBRv, CGGCATCAGTCATAATGACGAT; psmalphaFw, TATCAAAAGCTTAATCGAACAATTC; psmalphaRv, CCCCTTCAAATAAGATGTTCATATC) as described above. Expression of psmα was measured relative to that of a housekeeping gene gyrB. Data for each time point are from four independent samples.
9
RNA Extraction from C. lupini Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of RNA from pure cultures of C. lupini was performed from mycelium grown in Czapek Dox media with 0.5 g·L−1 of sucrose as described above. Mycelium was filtered through 0.45 µm cellulose acetate filter by Büchner filtration method and frozen in liquid nitrogen. One hundred milligrams of frozen mycelium was ground in a Mixer Mill (Retsch, MM400, Éragny, France) four times at a frequency of 30 Hz for one minute in lysing matrix A tube (MP biomedicals, Santa Ana, CA, USA). RNA extraction was performed with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Samples were shaken using Mixer Mill (Retsch, MM400, Éragny, France) three times at a frequency of 30 Hz for one minute, after adding lysing buffer RLT. A DNase digestion step with RNase-Free DNase Set (Qiagen, Hilden, Germany) was added after the nucleic acid precipitation step and following the manufacturer’s instructions.
10
RNA Extraction and Purification from Skin Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction and purification were performed as previously described86 (link). Briefly, dissected skin samples of eight individuals (four for each morph) were kept in RNAlater (Invitrogen) at − 20 °C. RNAlater was removed prior to homogenization. Skin samples and the appropriate amount of TRIzol (Invitrogen) (1 ml TRIzol per 100 mg sample) were homogenized in 2 ml Lysing Matrix A tube (MP Biomedicals) using FastPrep-24 Classic Instrument (MP Biomedicals). Subsequent purification and DNase treatment were performed with RNeasy Mini Kit (Qiagen) and RNase-Free DNase Set (Qiagen). Following extraction and purification, RNA was quantified using the Qubit RNA HS Assay Kit (Invitrogen) with a Qubit Fluorometer (Life Technologies). The RNA integrity number (RIN) was checked using an RNA 6000 Pico Kit (Agilent) on a 2100 Bioanalyzer System (Agilent).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!