Log In Sign up
The largest database of trusted experimental protocols

High pure rna isolation

Manufactured by Roche
Visit Supplier
Sourced in United States, Germany

The High Pure RNA Isolation kit is a laboratory equipment designed for the efficient extraction and purification of total RNA from a variety of sample types. It utilizes a silica-based membrane technology to capture and purify RNA, allowing for high-quality RNA suitable for downstream applications such as RT-PCR, Northern blotting, and other RNA-based analyses.

Automatically generated - may contain errors

Lab products found in correlation

High pure rna tissue kit, by Roche (2 mentions) Transcriptor first strand cdna synthesis kit, by Roche (2 mentions) Lightcycler, by Roche (1 mentions) Lightcycler 3, by Roche (1 mentions) Fast start universal sybr green master reagents, by Thermo Fisher Scientific (1 mentions) 7900ht system, by Thermo Fisher Scientific (1 mentions) Mlv reverse transcriptase, by Promega (1 mentions) Stepone with taqman pcr master mix, by Thermo Fisher Scientific (1 mentions) Rneasy ffpe kit, by Qiagen (1 mentions)

Spelling variants of this product

High Pure RNA Isolation Kit (1302 citations) High Pure FFPET RNA Isolation Kit (91 citations) High Pure FFPE RNA Isolation Kit (24 citations) MagNA Pure LC RNA Isolation Kit-High Performance (12 citations) High Pure Viral RNA Isolation Kit (6 citations) High pure total-RNA isolation kit (6 citations) MagNA Pure LC RNA Isolation Kit-High Performance kit (2 citations)

7 protocols using high pure rna isolation

1

Quantitative RT-PCR Analysis of Iron Regulatory Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from BMDM or livers by using the High Pure RNA Isolation and High Pure RNA Tissue kits (Roche Diagnostics), respectively. Total RNA (1 μg) was reverse transcribed with random hexamers using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics). IRP1 and TfR1 mRNAs levels were measured by real-time quantitative RT-PCR as described previously [16 (link)]. Specific cDNA fragments were amplified using the following pairs of oligonucleotide primers: IRP1, 5’-TCC ACC ACC CTG TTG CTG TAG-3’ (forward) and 5′-GCG TCG AAT ACA TCA AGG GT-3′ (reverse); L-Ft, 5′-CGG AGG GTC AAC ATG CTA TAA-3′ (forward) and 5′-AAG AGA CGG TGC AGA CTG GT-3′ (reverse); TfR1, 5′-TGC AGC AGC TCT TGA GAT TG-3′ (forward) and 5′-GTT GAG GCA GAC CTT GCA CT-3′ (reverse). The reactions were performed in a Light Cycler (Roche Diagnostics) and Light Cycler 3.5 Software was used for data analysis. Expression was quantified relative to that of control transcripts encoding glyceraldehyde 3-phosphate dehydrogenase (GAPDH), 5’-GAC CAC AGT CCA TGC CAT CAC-3’ (forward) 5’-TCC ACC ACC CTG TTG CTG TAG-3’ and18 S ribosomal RNA, 5′-CTG AGA AAC GGC TAC CAC ATC-3′ (forward) and 5′-CGC TCC CAA GAT CCA ACT AC-3′ (reverse).
Milczarek A., Starzyński R.R., Styś A., Jończy A., Staroń R., Grzelak A, & Lipiński P. (2017). A drastic superoxide-dependent oxidative stress is prerequisite for the down-regulation of IRP1: Insights from studies on SOD1-deficient mice and macrophages treated with paraquat. PLoS ONE, 12(5), e0176800.
+ Open protocol
+ Expand
2

RNA Extraction from Cells and Supernatants

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were trypsinized, washed with complete medium, then resuspended in 200 μL of PBS, then lysed and stocked at –80°C. RNA was subsequently extracted by High Pure RNA isolation (Roche, 11828665001) following manufacturer's instructions. For virus RNA extraction from supernatants, 200 μL of supernatant, cleared of cell debris by centrifugation at 2,000 rpm for 5 min at 4°C, was used instead of the 200 μL cell suspension in PBS.
Boussier J., Levi L., Weger-Lucarelli J., Poirier E.Z., Vignuzzi M, & Albert M.L. (2020). Chikungunya virus superinfection exclusion is mediated by a block in viral replication and does not rely on non-structural protein 2. PLoS ONE, 15(11), e0241592.
+ Open protocol
+ Expand
3

Total RNA Isolation and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded on 6-well plate (15 × 104/well). Total RNA was isolated by using High Pure RNA Isolation (Roche) according to the manufacturer’s instructions. cDNA synthesis from the total RNA samples were performed by using Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer’s instructions.
Karacicek B., Erac Y, & Tosun M. (2019). Functional consequences of enhanced expression of STIM1 and Orai1 in Huh-7 hepatocellular carcinoma tumor-initiating cells. BMC Cancer, 19, 751.
+ Open protocol
+ Expand
4

Quantitative Analysis of HO-1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA and cDNA were prepared using the HighPure RNA isolation and Transcriptor cDNA synthesis kits (Roche, Mannheim, Germany), respectively, according to the manufacturer’s protocol. qPCR was performed using the FastStart Universal SYBR Green Master reagents in the 7900 HT System (Applied Biosystems, Foster City, CA). The relative fold changes were normalized to Gapdh and calculated as folds of the control group using the 2–ΔΔCt method. The primer sequences used were as follows: HO-1, forward primer: CTGGAAGAGGAGATAGAGCGAA, reverse primer: TCTTAGCCTCTTCTGTCACCCT; Gapdh, forward primer: GACATGCCGCCTGGAGAAAC, reverse primer: AGCCCAGGATGCCCTTTAGT.
Zhang Q., Dang Y.Y., Luo X., Fu J.J., Zou Z.C., Jia X.J., Zheng G.D, & Li C.W. (2023). Kazinol B protects H9c2 cardiomyocytes from hypoxia/reoxygenation-induced cardiac injury by modulating the AKT/AMPK/Nrf2 signalling pathway. Pharmaceutical Biology, 61(1), 362-371.
+ Open protocol
+ Expand
5

Investigating hBMSCs Responses to nHAP

Check if the same lab product or an alternative is used in the 5 most similar protocols
hBMSCs were cultured in Free in Medium, Coating and 3D, and the experimental groups were treated with nHAP exposure (- 167 μg/ml, 7 days). At the end of 7 days of culture, total RNA was extracted (High Pure RNA Isolation, Roche Life Sciences). mRNA purification was performed by oligo(dT)-attached beads. Samples were run in the BGIseq500 platform (BGI-Shenzhen, China).
Bao F., Yi J., Liu Y., Zhong Y., Zhang H., Wu Z., Heng B.C., Wang Y., Wang Z., Xiao L., Liu H., Ouyang H, & Zhou J. (2022). Free or fixed state of nHAP differentially regulates hBMSC morphology and osteogenesis through the valve role of ITGA7. Bioactive Materials, 18, 539-551.
+ Open protocol
+ Expand
6

Quantifying HIV Transcription in PKC412 and VOR Treated Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ACH2 cells were treated with PKC412 or/and VOR for 24 to 48 h and intracellular RNA was extracted using High Pure RNA isolation (Roche) and subjected to reverse transcription with MLV reverse transcriptase (Promega, Madison, USA). HIV transcription was measured by real time PCR using primers corresponding to the HIV 5′LTR and gag (R-gag) (forward, 5′-ATCAAGCAGCCATGCAAATG-3′, and reverse, 5′-CTGAAGGGTACTAGTA GTTCC-3′) and normalized to the GAPDH gene levels using following primers: 5-TGGGTGTGAACCATGAGAAG-3; 5-ATGGACTGTGGTCATGAGTC-3.
Ao Z., Zhu R., Tan X., Liu L., Chen L., Liu S, & Yao X. (2016). Activation of HIV-1 expression in latently infected CD4+ T cells by the small molecule PKC412. Virology Journal, 13, 177.
+ Open protocol
+ Expand
7

RNA Extraction and qPCR Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cultured cells and whole lungs using High Pure RNA Isolation and High Pure RNA Tissue kits (Roche Applied Science, Penzberg, Germany), respectively. RNA from human autopsy samples was isolated using an RNeasy FFPE kit (Qiagen, Germantown, MD). Total RNA was extracted, and 1µg of total RNA was reverse-transcribed to cDNA according to the procedure previously described. Real-time quantitative PCR analysis was performed using StepOne with Taqman PCR master mix (Applied Biosystems, Foster City, CA). The thermal cycling conditions included 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of amplification at 95°C for 15 s and 55°C for 1.5 min for denaturing and annealing, respectively. Quantification of the genes of interests were normalized to GAPDH and expressed as fold increases over the negative control for each treatment at each time point, as previously described (7 (link)).
Ito T., Itakura J., Takahashi S., Sato M., Mino M., Fushimi S., Yamada M., Morishima T., Kunkel S.L, & Matsukawa A. (2016). Sprouty-related Ena/VASP homology 1-domain-containing protein-2 (Spred-2) critically regulates influenza A virus (H1N1)-induced pneumonia. Critical care medicine, 44(7), e530-e543.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!