Rpb1 ntd

Manufactured by Cell Signaling Technology

RPB1 NTD is a protein that is part of the largest subunit of RNA polymerase II. It plays a critical role in the initiation and elongation stages of transcription.

Automatically generated - may contain errors

Lab products found in correlation

Tfiib, by Cell Signaling Technology (1 mentions) Cpsf73, by Fortis Life Sciences (1 mentions) H3k36me2, by Abcam (1 mentions) Cstf 64, by Fortis Life Sciences (1 mentions) H3k36me3, by Abcam (1 mentions) Ab9110, by Cell Signaling Technology (1 mentions)

Spelling variants of this product

Rpb1 NTD (D8L4Y) Rabbit MAb #14958 (Pol II) (2 citations) Anti-Rpb1 NTD (2 citations) Rpb1 NTD (D8L4Y) (2 citations)

2 protocols using rpb1 ntd

Antibody Validation for ChIP-seq and Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols

The antibodies used in this study are as follows: for ChIP-seq, RPB1 NTD (Cell Signaling Technology, 14958, lot #1), RPB1 Ser² (Abcam, 5095, lot #GR3225147-1), H3K36me3 (Abcam, 9050, lot #GR3257952-1), H3K36me2 (Abcam, 9049, lot #GR3236147-1), CSTF64 (Bethyl Laboratories, A301-92A, lot #A301-092A-2), and CPSF73 (Bethyl Laboratories, A301-019A, lot #A301-091A-1); for Western blot, INTS11 (Atlas Antibodies, HPA029025, lot #A107128), lamin A (Active Motif, 39961, lot #33310001), TFIIB (Cell Signaling Technology, 4169s, lot #1), CPSF100 (Bethyl Laboratories, A301-583A-M, lot #A301-583A-M-1), CSTF50 (Bethyl Laboratories, A301-250A-M, lot #A301-250A-M-3), CSTF64 (Bethyl Laboratories, A301-092A-M, lot #A301-092A-M-2), CPSF73 (Bethyl Laboratories, A301-091A-M, lot #A301-091A-M-1), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Abcam, ab8245, lot #GR3317834-1).

Dasilva L.F., Blumenthal E., Beckedorff F., Cingaram P.R., Gomes Dos Santos H., Edupuganti R.R., Zhang A., Dokaneheifard S., Aoi Y., Yue J., Kirstein N., Tayari M.M., Shilatifard A, & Shiekhattar R. (2021). Integrator enforces the fidelity of transcriptional termination at protein-coding genes. Science Advances, 7(45), eabe3393.

+ Open protocol

+ Expand

ChIP-qPCR Analysis of CDK7 and Rpb1 in H460 and H1975 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP was performed on H460 cells transfected with a control YFP or CDK7 HA construct, or on H460 and H1975 cells 6 h after treatment with DMSO, Milciclib, THZ1, or LDC4297 (10 μM) using the SimpleChIP Plus ChIP kit (Cell Signaling) following the manufacturer’s protocol. The following antibodies were used: HA (Abcam; ab9110; 1:714 dilution), Rpb1 NTD (Cell Signaling; D8L4Y; 1:147 dilution), and phospho-Ser5 Rpb1 CTD (Cell Signaling; D9N5I; 1:50 dilution). qPCR was performed as previously described using the following primers:
GLUT1 (SLC2A1) forward primer: CCCTAGTGCACCGAAGTCAC
GLUT1 (SLC2A1) reverse primer: GTACCCGGCTGTAAGGCAAG

Ghezzi C., Wong A., Chen B.Y., Ribalet B., Damoiseaux R, & Clark P.M. (2019). A high-throughput screen identifies that CDK7 activates glucose consumption in lung cancer cells. Nature Communications, 10, 5444.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!