Prfp c rs vector

The METTL7A Human shRNA Plasmid Kit (Origene, Cat. TF311498, MD, USA) and pRFP-C-RS Vector (Origene, Cat. TR30014, MD, USA) was used. The plasmid contains the sequence that inhibits METTL7A mRNA and the restriction enzyme sites that are responsive to chloramphenicol and puromycin. To confirm the transfection efficiency, the RFP gene was inserted into the vector. The pRFP-C-RS shRNA vector was used as the control. Transfection was performed using 2.5 µg of TurboFectin transfection reagent (Origene, Cat. TF81001, MD, USA) mixed with 2 × 10⁵ cells according to the manufacturer’s instructions. Transfected cells were cultured for 2 days at 37 °C under an atmosphere of 5% CO₂ and selected with 2 µg/mL puromycin for 3 days. The transfection efficiency was confirmed through fluorescence expression.

C9orf72 cDNA (HsCD00398737) was obtained from Arizona State University and SMCR8 cDNA (HsCD00347993) from Harvard Plasmid Repositories. The C9orf72 constructs were generated using the Gateway cloning system (ThermoFisher, Waltham, MA) with a C-terminal 3xFlag or V5 tag. The SMCR8 constructs were generated with an N-terminal Flag or mCherry tag using Gateway or classical cloning methods, respectively. All shRNAs were cloned into the pRFP-C-RS vector (Origene), which was modified to remove the RFP coding sequence via digestion with MluI and BglII followed by blunting and religation. The following shRNA sequences were used: 5’ctgtgttacctcctgaccagtcagattga 3’ (SMCR8); 5’cttccacagacagaacttagtttctacct 3’ (C9orf72). The autophagy luciferase assay plasmids were kindly provided by Brian Seed (Harvard) and the normalization plasmid pCMV-SEAP was from Addgene (24595, Alan Cochrane, University of Toronto). GFP-TFEB was obtained from Addgene (38119, Shawn Ferguson, Yale University). GFP-TFEB used for MEF experiments was described before [55 (link)]. For GFP-LC3, human LC3 was cloned into pEGFP-C1. RFP-Rab7 was generated from EGFP-Rab7 (a kind gift from Bo van Deurs at University of Copenhagen) by exchanging EGFP into RFP.

The complementary DNAs for human S100A6 and the negative control DNA were inserted into a GV146 plasmid vector purchased from Genechem (Shanghai, China). A shRNA sequence targeting β-catenin (5′-ATCACTGAGCCTGCCATCTGTGCTCTTCG-3′) and a negative control sequence were synthesized and ligated into the pRFP-C-RS vector (Origene Technologies, USA). The plasmids were amplified according to the manufacturer’s instructions. Sequence analysis after cloning revealed 100% homology to published sequences.