For the PpV rescue construct, a 2679 bp EcoRI fragment from BAC clone 18C-18 (BACPAC Resources Center) was isolated and cloned into the pattB vector (Bischof et al. 2007 (link)). For GFP-PpV, the 5′ terminal 444 bp (a HindIII/EcoRI-BspM1 fragment) was replaced by a corresponding 1229 bp fragment with codon optimized GFP and a linker inserted at the start codon, which was synthesized by Eurofins Genomics and cloned into the pattB vector. CS2-tribbles plasmid template was linearized by XhoI and transcribed by SP6 Transcription Kit (Ambion) (Grosshans and Wieschaus 2000 (link)). dsRNAs were produced by T7 RNA polymerase (Ambion), NTPs, RNase inhibitor (Thermo Fisher) and Pyrophosphatase (Thermo Fisher), using CS2-tribbles as template and dsRNA primers BL10 (GTAATACGACTCACTATAGGGCGATCAGCGCACAGCCTAGTCA) and BL11 (GTAATACGACTCACTATAGGGCGATGGCCATAGATGGTGCTCC) (Farrell and O’Farrell 2013 (link)).
Pyrophosphatase
Manufactured by Thermo Fisher Scientific
Pyrophosphatase is an enzyme that catalyzes the hydrolysis of pyrophosphate to two phosphate ions. It is used in various biochemical applications to maintain the equilibrium of pyrophosphate and phosphate in reactions.
Automatically generated - may contain errors
Lab products found in correlation
Dntps, by Thermo Fisher Scientific (2 mentions)
Exo resistant random primer, by Thermo Fisher Scientific (2 mentions)
Bovine serum albumin (bsa), by New England Biolabs (2 mentions)
Bglii, by New England Biolabs (2 mentions)
Phi29 polymerase, by Thermo Fisher Scientific (2 mentions)
Restriction enzyme buffer, by New England Biolabs (2 mentions)
Milliq, by New England Biolabs (2 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (1 mentions)
Sp6 transcription kit, by Thermo Fisher Scientific (1 mentions)
T7 rna polymerase, by Thermo Fisher Scientific (1 mentions)
Phi29 buffer, by Thermo Fisher Scientific (1 mentions)
Annealing buffer, by Thermo Fisher Scientific (1 mentions)
Synergy h1, by Agilent Technologies (1 mentions)
Spheroid microplate, by Corning (1 mentions)
Recombinant rnase inhibitor, by Takara Bio (1 mentions)
Myokinase, by Merck Group (1 mentions)
Creatine kinase, by Roche (1 mentions)
Ribosomes, by New England Biolabs (1 mentions)
T7 rnap, by New England Biolabs (1 mentions)
Malachite green solution, by Cell Signaling Technology (1 mentions)
7 protocols using pyrophosphatase
1
Genetic manipulation of PpV in Drosophila
2
Circular DNA Amplification and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Circular DNA obtained by the circularization reaction was combined with 12 μl 5× Annealing buffer (50 mM Tris @ pH 7.5–8.0, 250 mM NaCl, 5 mM EDTA) and 1 μl Exo-resistant random primers (Thermofisher), heated for 5 min at 98 °C and then cooled down at room temperature. Subsequently, the RCA mix (previous reaction mixture, 10 μl 10× Phi29 Buffer (Thermofisher), 2 μl BSA (New England Biolabs), 10 μl dNTPs (Thermofisher), 4 μl pyrophosphatase (Thermofisher), 2 μl Phi29 Polymerase (Thermofisher), and MQ (to a volume of 100 μl)) was prepared. RCA was performed overnight at 30 °C. The RCA-reaction was inactivated by 10 min incubation at 70 °C.
To test whether CyclomicsSeq worked, 4 μl of RCA mixture was incubated with a restriction enzyme that specifically cuts backbone-backbone interactions, but not backbone-insert interactions. Briefly, 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ, and 1 μl BglII (New England Biolabs). The reaction mixture was incubated for 1 h at 37 °C and then ran on a 1.5% Agarose gel.
To test whether CyclomicsSeq worked, 4 μl of RCA mixture was incubated with a restriction enzyme that specifically cuts backbone-backbone interactions, but not backbone-insert interactions. Briefly, 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ, and 1 μl BglII (New England Biolabs). The reaction mixture was incubated for 1 h at 37 °C and then ran on a 1.5% Agarose gel.
3
Cell-free Protein Synthesis Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 2.5× reaction buffer was composed of amino acid mixture (0.75 mM for each amino acid), 8.125 mg/mL tRNA (Roche), 5 mM ATP, 5 mM GTP, 2.5 mM CTP, 2.5 mM UTP, 50 mM creatine phosphate, 50 μg/mL folinic acid, 125 mM HEPES–KOH 7.6, 250 mM potassium glutamate, 29.5 mM magnesium acetate, 5 mM spermidine, and 2.5 mM DTT. 10× enzyme mixture was composed of 200 μg/mL creatine kinase (Roche), 300 μg/mL myokinase (Sigma-Aldrich), 50 μg/mL nucleoside 5′-diphosphate kinase from bovine liver (Sigma-Aldrich), 20 U/μL T7 RNAP (New England BioLabs), 0.002 U/μL pyrophosphatase (Thermo Fisher Scientific) and 8 U/μL recombinant RNAse inhibitor (Takara). Reactions (final volume = 10 μL) were initiated by mixing 4 μL 2.5×reaction buffer, 1 μL 10× Enzyme mixture, 15 μg MSBC-PURE, 6 μg EF-Tu, 1.0 μM ribosomes (New England BioLabs), and 50 ng of linear DNA template. After mixing, reactions were incubated at 37 °C for 4 h. The mRFP was quantified by a platereader (Biotek Synergy H1) with the excitation at 580 nm and the emission at 610 nm using a 384-well plate (Corning Spheroid Microplate).
4
Quantifying cGAS Enzymatic Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cGAS activity was assayed by using the Pyrophosphatase-coupled assay51 . One microgram of WT or mutant cGAS was mixed with 100 μM ATP, 100 μM GTP, and 0.1 U Pyrophosphatase (Thermo Fisher) in reaction buffer (20 mM Tris-Cl [pH 7.5], 150 mM NaCl, 5 mM MgCl2, 1 mM dithiothreitol [DTT]) with or without HT-DNA (1 μg/ml). After 1 h of incubation at 25 °C, the reaction was stopped by adding an equal volume of quench solution (reaction buffer minus Mg++ plus 25 mM EDTA). Quenched solutions (25 μl) were mixed with 25 μl malachite green solution (Cell Signaling) and incubated for 15 min at RT. Absorbance at 620 nm was compared to phosphate standard to determine the concentration of phosphate in each well. Phosphate concentrations of control reactions without recombinant cGAS were subtracted from reactions containing recombinant cGAS. The measurement was repeated at least three times, and the results are presented as the enzymatic activity percentage against WT cGAS.
5
In Vitro Transcription of mRNA from pT7TS Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pT7TS plasmid was linearized for 4 h with the restriction enzyme SmaI (Fermentas) as a DNA template for mRNA in vitro transcription. The linearized pT7TS DNA in 200 μL was recovered by precipitating it with 40 μL 5 M NaOAc (Invitrogen) and 480 μL 100% EtOH, followed by 30 min of chilling at −20°C. The linearized pT7TS DNA was washed twice with 1 mL 75% EtOH after being centrifuged at 15,000 rpm for 20 min at 4°C. Following air drying, pT7TS DNA was resuspended to 1 μg/μL in H2O (Sigma). A single in vitro transcription reaction of TS mRNA in 40 μL contained 1 μg pT7TS DNA as a template, 5 mM guanosine triphosphate, ATP, cytidine triphosphate, and N1-methyl-pseudoUTP (TriLink, San Diego), 4 mM CleanCap AG 3′Ome, 0.002 U/μL pyrophosphatase (Thermo Fisher Scientific), 1 U RNase inhibitor, and 10 U/μL T7 polymerase; the reaction was incubated for 90 min at 37°C. The TS mRNA was isolated from the in vitro transcription reaction by using a MegaClear RNA purification kit (Thermo Fisher Scientific) and resuspended in H2O for LNP preparation.
6
Cap-Labeled RNA Synthesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Typical in vitro transcription reaction (20 µL) was incubated at 37°C for 3 h and contained RNA polymerase buffer (40 mM Tris HCl pH 7.9, 10 mM MgCl2, 1 mM DTT, 2 mM spermidine), 10 U/µl T7 polymerase (ThermoFisher Scientific, HC, 200 U/µl), 0.0125 U/µl pyrophosphatase (ThermoFisher Scientific), additional 15 mM MgCl2, 1 U/µl RiboLock RNase inhibitor (ThermoFisher Scientific), and either 1) 5 mM CTP/UTP/GTP and 4 mM ATP and 10 mM cap analog of interest (2.5-fold excess of FAD or FADpG) for 40 ng/µl A φ 2.5 DNA template or 2) 5 mM CTP/UTP/ATP with 4 mM GTP and 10 mM cap analog (GlcppUpG or NAcGlcppUpG) for 40 ng/µl of G φ 6.5 DNA template. Following 3 h incubation, the template was removed by treatment with 1 U/µl DNase I for 30 min at 37°C. The obtained RNAs were purified using 500 µg Monarch RNA clean-up kit (New England Biolabs). Transcript homogeneity was analyzed on 15% acrylamide/7 M urea gels/1⨯ TBE and stained with SYBR Gold, whereas the concentration was determined spectrophotometrically.
7
Circular DNA Amplification and Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Circular DNA obtained by the circularization reaction was combined with 12 μl 5X Annealing buffer (50 mM Tris @ pH 7.5-8.0, 250 mM NaCl, 5 mM EDTA) and 1 μl Exo-resistant random primers (Thermofisher), heated for 5 minutes at 98°C and then cooled down at room temperature. Subsequently, the RCA mix (previous reaction mixture, 10 μl 10X Phi29 Buffer (Thermofisher), 2 μl BSA (New England Biolabs), 10 μl dNTPs (Thermofisher), 4 μl pyrophosphatase (Thermofisher), 2 μl Phi29 Polymerase (Thermofisher), and MQ (to a volume of 100 μl)) was prepared. RCA performed overnight at 30°C. The RCA-reaction was inactivated by 10 minute incubation at 70°C.
To test whether CyclomicsSeq worked, 4 μl of RCA mixture was incubated with a restriction enzyme that specifically cuts backbone-backbone interactions, but not backbone-insert interactions. Briefly, 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ, and 1 μl BglII (New England Biolabs). The reaction mixture was incubated for 1 hour at 37°C and then ran on a 1.5% Agarose gel.
To test whether CyclomicsSeq worked, 4 μl of RCA mixture was incubated with a restriction enzyme that specifically cuts backbone-backbone interactions, but not backbone-insert interactions. Briefly, 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ, and 1 μl BglII (New England Biolabs). The reaction mixture was incubated for 1 hour at 37°C and then ran on a 1.5% Agarose gel.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!