Psv β galactosidase vector

Manufactured by Promega

Sourced in United States

The PSV-β-galactosidase vector is a plasmid DNA construct that contains the gene encoding the β-galactosidase enzyme. This vector is commonly used as a reporter system for gene expression studies in various cell types.

Automatically generated - may contain errors

Lab products found in correlation

16 protocols using psv β galactosidase vector

Prostate Epithelial Cell Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RWPE-1 prostate epithelial cells were purchased from ATCC via LGC Standards. PC-3 cells were kindly provided by Prof. Norman Maitland (University of York, UK; [16] ). CHO cells were originally obtained from ECACC.
The pMIR-REPORT Luciferase vector and pre-miR molecules were purchased from Ambion (Warrington, UK). The pRL-TK vector, pSV-β-galactosidase vector and dual-luciferase reporter assay system were from Promega (Southampton, UK). The pcDNA3 mammalian expression vector, Lipofectamine2000, Oligofectamine and keratinocyte serum-free medium (SFM) were from Invitrogen (Paisley, UK).
The following antibodies were used at the following dilutions: monoclonal anti-V5 antibody 1∶500 (Invitrogen), goat polyclonal anti-ECE-1 1:1000 (R&D Systems), rabbit polyclonal anti-Upf1 1:200 (Santa Cruz) and monoclonal anti-β-actin 1∶10,000 (Sigma).

Whyteside A.R., Turner A.J, & Lambert D.W. (2014). Endothelin-Converting Enzyme-1 (ECE-1) Is Post-Transcriptionally Regulated by Alternative Polyadenylation. PLoS ONE, 9(1), e83260.

+ Open protocol

+ Expand

Transient Transfection and Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

KPC cells were transiently cotransfected with pNFκB‐Met‐Luc reporter plasmid (Clontech Laboratories, Mountain View, CA, USA) and internal control pSV‐β‐Galactosidase Vector (Promega Corp., Madison, WI, USA) by FugeneHD (Promega Corp.). After 48 hours, the medium was replaced with DMEM containing 10% FCS, collected 8 hours later, and luciferase activities were quantified using a Ready‐To‐Glow Secreted Luciferase Reporter System (Clontech Laboratories). Values were normalized relative to β‐galactosidase activity detected by β‐Galactosidase Enzyme Assay System (Promega Corp.).

Iida‐Norita R., Kawamura M., Suzuki Y., Hamada S., Masamune A., Furukawa T, & Sato Y. (2019). Vasohibin‐2 plays an essential role in metastasis of pancreatic ductal adenocarcinoma. Cancer Science, 110(7), 2296-2308.

+ Open protocol

+ Expand

Quantification of NF-κB Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols

A NF-κB report plasmid, pSV-β-galactosidase vector, and luciferase assay kit were purchased from Promega (Madison, WI, USA). The cells were cotransfected with the NF-κB report plasmid (0.7 μg) and the pSV-β-galactosidase vector (0.3 μg) for 24 h by using Lipofectamine 3000 (Invitrogen). According to the manufacturer's recommendations, cell extracts were prepared, and luciferase and β-galactosidase activities were then measured.

Liu J.F., Tsao Y.T, & Hou C.H. (2016). Fractalkine/CX3CL1 induced intercellular adhesion molecule-1-dependent tumor metastasis through the CX3CR1/PI3K/Akt/NF-κB pathway in human osteosarcoma. Oncotarget, 8(33), 54136-54148.

+ Open protocol

+ Expand

Resistin-Dependent Signaling Pathway Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The recombinant human resistin was purchased from R&D Systems (Minneapolis, MN, USA). We purchased p85, Akt, and β-actin primary antibodies (Santa Cruz Biotechnology, CA, USA), as well as rabbit polyclonal antibodies specific for p-p85 and p-Akt (Cell Signaling Technology, Danvers, MA, USA). The miR-16-5p mimic, miRNA control, Lipofectamine 2000, and Trizol were purchased from Life Technologies (Carlsbad, CA, USA). Dharmacon Research (Lafayette, CO, USA) supplied ON-TARGETplus siRNAs. Gibco-BRL life technologies (Grand Island, NY, USA) supplied fetal bovine serum (FBS), DMEM, α-MEM, and all other cell culture reagents. Promega (Madison, WI, USA) supplied the pSV-β-galactosidase vector and luciferase assay kits. All other chemicals or inhibitors were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Chen S.S., Tang C.H., Chie M.J., Tsai C.H., Fong Y.C., Lu Y.C., Chen W.C., Lai C.T., Wei C.Y., Tai H.C., Chou W.Y, & Wang S.W. (2019). Resistin facilitates VEGF-A-dependent angiogenesis by inhibiting miR-16-5p in human chondrosarcoma cells. Cell Death & Disease, 10(1), 31.

+ Open protocol

+ Expand

NF-κB Transactivation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The NF-κB report plasmid, pSV-β-galactosidase vector and luciferase assay kit were purchased from Promega (Madison, WI, USA). Cells (2 × 10⁵ cell/well) were co-transfected with NF-κB report plasmid and pSV-β-galactosidase vector for 24 h using Lipofectamine 3000™ (Invitrogen). Transactivation was determined by monitoring firefly luciferase levels in the pGL2 vector. The luciferase assay was performed by adding lysis buffer (100 μL), and cells were harvested by centrifugation (13,200 rpm for 5 min). The supernatant was transferred to fresh tubes, and 20 μL of cell lysate was added to 80 μL of fresh luciferase assay buffer in an assay tube. Luciferase activity was measured using a microplate luminometer and normalized to transfection efficiency based on the cotransfected β-galactosidase expression vector.

Chao C.C., Lee C.W., Chang T.M., Chen P.C, & Liu J.F. (2020). CXCL1/CXCR2 Paracrine Axis Contributes to Lung Metastasis in Osteosarcoma. Cancers, 12(2), 459.

+ Open protocol

+ Expand

Molecular Mechanisms of CXCL1/CXCR2 Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemical reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA). The CXCL1, CXCR2, VCAM-1, p-FAK, FAK, p-p85α, p85α, p-Akt, Akt, p-IKKα/β, IKKα/β, p-IκBα, IκBα, p-p65, p65, and β-Actin specific anti-mouse and anti-rabbit IgG-conjugated horseradish peroxidase antibodies were purchased from GeneTex International Corporation (Hsinchu City, Taiwan). Recombinant human CXCL1 was purchased from PeproTech (Rocky Hill, NJ, USA). Short hairpin RNA (shRNA) plasmid for CXCR2 and VCAM-1 were obtained from the National RNAi Core Facility Platform (Taipei, Taiwan). All siRNAs were ON-TARGETplus siRNAs, obtained from Dharmacon Research (Lafayette, CO, USA). The NF-κB luciferase report plasmid, pSV-β-galactosidase vector, and luciferase assay kit were purchased from Promega (Madison, WI, USA).

Lee C.W., Chiang Y.C., Yu P.A., Peng K.T., Chi M.C., Lee M.H., Fang M.L., Lee K.H., Hsu L.F, & Liu J.F. (2021). A Role of CXCL1 Drives Osteosarcoma Lung Metastasis via VCAM-1 Production. Frontiers in Oncology, 11, 735277.

+ Open protocol

+ Expand

Quantifying FOXO1 Nuclear Activity in Gastric Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine FOXO1 nuclear DNA-binding activity in GC cells, luciferase reporter assay was performed as previously described (Park et al, 2014 (link)). Gastric cancer cells were seeded in 24-well plates at a density of 3 × 10⁴ cells per well and were transiently cotransfected with 0.4 μg forkhead responsive element (FHRE)-luciferase reporter plasmid (reporter construct in which a small region of the Fas ligand promoter contains the three FHREs, Addgene plasmid 1789, Addgene Incorp, Cambridge, MA, USA)) and 0.4 μg pSV-β-galactosidase vector (Promega, Madison, WI, USA), an internal control, using Lipofectamine Plus (Life Technologies). Twenty-four hours after transfection, assays for luciferase and β-galactosidase were carried out using a Dual-Luciferase Reporter Assay System (Promega). Luciferase activity was measured on an AutoLumat LB 9505c luminometer (Berthold Analytical Instruments, Nashua, Germany) and was normalised by β-galactosidase activity.

Ko Y.S., Cho S.J., Park J., Kim Y., Choi Y.J., Pyo J.S., Jang B.G., Park J.W., Kim W.H, & Lee B.L. (2015). Loss of FOXO1 promotes gastric tumour growth and metastasis through upregulation of human epidermal growth factor receptor 2/neu expression. British Journal of Cancer, 113(8), 1186-1196.

+ Open protocol

+ Expand

Signaling Pathways Modulation by CCN6

Check if the same lab product or an alternative is used in the 5 most similar protocols

We purchased p85α, Akt1, p-IKKα/β (Ser180/Ser181), p-IκBα, p65 (Ser536), IKKα/β, IκBα, p65, CCN6, and β-actin primary antibodies (Santa Cruz Biotechnology, CA, USA), and rabbit polyclonal antibodies specific for p-p85 (Y458), p-Akt (S473), p-mTOR (Ser2448), and mTOR (Cell Signaling Technology, Danvers, MA, USA). Recombinant human CCN6 was purchased from PerpoTech (Rocky Hill, NJ, USA) and CCN6 short hairpin (sh)RNA expression plasmids from RNAiCore (Taipei, Taiwan). The D-Luciferin potassium salt was purchased from Gold Biotechnology (St. Louis, MO, USA). Lipofectamine 2000 and TRIzol were purchased from Life Technologies (Carlsbad, CA, USA). Dharmacon Research (Lafayette, CO, USA) supplied ON-TARGETplus siRNAs. Gibco-BRL life technologies (Grand Island, NY, USA) supplied DMEM, α-MEM, fetal bovine serum (FBS), and all other cell culture reagents. The Matrigel was purchased from BD (Biosciences, Bedford, MA, USA) and Promega (Madison, WI,) supplied the pSV-β-Galactosidase Vector and luciferase assay kits. All other USA chemicals or inhibitors that we used were supplied by Sigma-Aldrich (St. Louis, MO, USA).

Tzeng H.E., Tang C.H., Wu S.H., Chen H.T., Fong Y.C., Lu Y.C., Chen W.C., Huang H.D., Lin C.Y, & Wang S.W. (2018). CCN6-mediated MMP-9 activation enhances metastatic potential of human chondrosarcoma. Cell Death & Disease, 9(10), 955.

+ Open protocol

+ Expand

Evaluating TGFB1 Promoter Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

The effects of XCT-790 on the transcription activity of TGFB1 promoter were evaluated by use of a luciferase reporter assay on the basis of the previous study [16]. Briefly, the −436/+55 bp flanking the transcription start site of the human TGFB1promoter was cloned to generate the pTGF-β-luciferase plasmid. Then cells were transfected with pTGF-β-luciferase (250 ng) and the pSV-β-galactosidase vector (25 ng) (Promega, USA) and further treated with or without XCT-790. The luciferase activity (Promega, USA) and β-galactosidase activity (Applied Biosystems, Foster City, CA, USA) were analyzed by use of commercial kits according to the instructions.

Huang X., Wang X., Shang J., Zhaang Z., Cui B., Lin Y., Yang Y., Song Y., Yu S, & Xia J. (2018). Estrogen related receptor alpha triggers the migration and invasion of endometrial cancer cells via up regulation of TGFB1. Cell Adhesion & Migration, 12(6), 538-547.

+ Open protocol

+ Expand

Measuring FOXO1 DNA-Binding Activity

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine FOXO1 nuclear DNA-binding activity, luciferase reporter assay was used as previously described with slight modifications [10 (link),11 (link)]. Two oligonucleotides (GCAAAACAAACTTATTTTGAAGCAAAACAAACT TATTTTGA AGCAAAACA AACT TATTTTGAA and TTCA AAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTG TT CAAAATAAGTTTGTTTTGC) were annealed and ligated into the pGL4.27-Promoter vector (Promega, Madison, WI) to create 3XIRS-luciferase (Cosmo GENETECH, Seoul, Korea). This construct has three tandem repeats of a FOXO1 binding element, the insulin-responsive sequence (IRS), inserted upstream of the luciferase reporter gene. It is widely used as an indicator of FOXO1 transcriptional activity. GC cells were cotransfected transiently with 0.4 μg 3XIRS-luciferase vector and 0.4 μg pSV-β-galactosidase vector (Promega), an internal control, using Lipofectamine Plus (Life Technologies). Twenty-four hours after transfection, assays for luciferase and β-galactosidase were carried out using a Dual-Luciferase Reporter Assay System (Promega). FOXO1 luciferase activity was measured on an AutoLumat LB 9505c luminometer (Berthold Analytical Instruments, Nashua, Germany) and was normalized by β-galactosidase activity.

Kim S.Y., Ko Y.S., Park J., Choi Y., Park J.W., Kim Y., Pyo J.S., Yoo Y.B., Lee J.S, & Lee B.L. (2015). Forkhead Transcription Factor FOXO1 Inhibits Angiogenesis in Gastric Cancer in Relation to SIRT1. Cancer Research and Treatment : Official Journal of Korean Cancer Association, 48(1), 345-354.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!