RNeasy Mini Kit (Qiagen) was used for viral RNA extraction from the culture supernatants of different SFTSV isolates. The viral RNA was then used for the synthesis of cDNA through the application of RevertAid™ First strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). As described previously, using the primers designed according to the published sequences of the SFTSV, conventional PCR was applied for the sequencing of the whole genome of the SFTSV isolates. The terminal ends of viral RNA segments were determined with a RACE Kit (Invitrogen, USA). The whole genomic sequences were further confirmed through the application of the sequence-independent, single-primer amplification (SISPA) method [2] (link). The Gn, Gc, and Np gene DNA sequences of the SFTSV isolates were compared to the National Center for Biotechnology Information (NCBI) database through BLAST. Based on the sequences of the nucleocapsid genes, phylogenetic analysis was done using the Mega 5.10 software.
Race kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The RACE) kit is a laboratory product designed for rapid amplification of cDNA ends. It is used to determine the complete sequence of a messenger RNA (mRNA) transcript by identifying the 5' and 3' ends. The kit provides a set of reagents and protocols to enable this process.
Automatically generated - may contain errors
Lab products found in correlation
Top10 vector, by Thermo Fisher Scientific (2 mentions)
Q5 dna polymerase, by New England Biolabs (2 mentions)
Superase in rnase inhibitor, by Thermo Fisher Scientific (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Miseq platform, by Illumina (2 mentions)
Accuscript high fidelity reverse transcriptase, by Agilent Technologies (2 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
E coli top10 cells, by Thermo Fisher Scientific (1 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Takara Bio (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Wizard sv gel and pcr clean up system, by Promega (1 mentions)
Peasy t5 vector, by Transgene (1 mentions)
Trans t1 competent cells, by Transgene (1 mentions)
Dnaman version 6 program, by Lynnon Biosoft (1 mentions)
Sanger sequencing, by Sangon (1 mentions)
Dh5α competent cells, by Thermo Fisher Scientific (1 mentions)
3730xl dna analyzer platform, by Thermo Fisher Scientific (1 mentions)
11 protocols using race kit
1
Whole Genome Sequencing of SFTSV Isolates
2
Identification of 5'UTR Sequence Using RACE
3
Rapid Amplification of cDNA Ends (RACE)
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5′ and 3′ RACE was performed using the RACE kit (Invitrogen) as directed by the manufacturer. A nested set of PCRs was performed to isolate the target sequence. The first PCR reaction used the AAP primer and a gene specific primer; whereas the second nested reaction used the AUAP primer and a second gene specific primer. 3′ RACE was performed as for gene expression cDNA synthesis with the modification of using the 3′ AP primer to create a 3′ adapter. The 3′ target sequence was amplified through PCR using a nested set of gene specific primers and the adapter specific 3′ AUAP primer. All 3′ and 5′ RACE primers are listed in Additional file
13 : Table S8.
4
Mapping Transcription Start Sites of papX and focX
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cultures of ΔpapX and ΔfocX strains grown overnight were diluted 1:100 in LB medium and cultured at 37°C to the mid-logarithmic growth phase. An aliquot was collected for RNA extraction and treated with a stop solution (95% EtOH, 5% phenol) to preserve RNA stability. To determine the transcriptional start site of papX and focX, we used a 5′ rapid amplification of cDNA ends (RACE) kit (Invitrogen) according to the manufacturer’s guidelines, and the primers are listed in Table S2 in the supplemental material. cDNA was inserted into pCR2.1-TOPO via the TOPO TA cloning kit (Invitrogen) and transformed into E. coli Top10 cells (Invitrogen). Transformants were plated on LB with ampicillin, and plasmids were isolated by miniprep and sequenced to determine the papX and focX transcription initiation sites.
5
Isolation and Characterization of PvPin1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from P. violascens was isolated by using RNAiso Plus (Takara, Shiga, Japan), then Reverse Transcriptase M-MLV (Takara, Japan) was used to synthesize first-strand cDNA. A specific Pin1-like cDNA fragment (approximately 300 bp) was amplified by using the pair of primers (Pin1-1 and Pin1-2, Table 1 ), which were designed by comparing the amino acid sequences of Pin1 homologs from grass family plants including P. edulis (FP099633.1), O. rufipogon (CU406178.1), O. sativa (AK243434.1), Triticum aestivum (AK333419.1), and Zea mays (NM001157033.1). The 3′ end and 5′ partial cDNA of Pin1-like were isolated with the RACE kit (Invitrogen) by using gene-specific primers (3′-1 and 3′-2; 5′-1 and 5′-2, Table 1 ). Finally, the full-length ORF sequence was obtained by using the primers (ORF-F and ORF-R, Table 1 ) based on the known 5′ and 3′ sequences.
Genomic DNA was isolated by the modified CTAB method (Reichardt and Rogers, 1993 ) from leaves. Then a 2709-bp intron sequence of PvPin1 was obtained by using the primers ORF-F and ORF-R.
Genomic DNA was isolated by the modified CTAB method (Reichardt and Rogers, 1993 ) from leaves. Then a 2709-bp intron sequence of PvPin1 was obtained by using the primers ORF-F and ORF-R.
6
RACE Method for Viral UTR Determination
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 5’- and 3’-UTR sequences of the viral genome were obtained using a RACE kit (Invitrogen) according to the manufacturer’s protocol, on a template of viral RNA extracted from purified virus preparations. The RACE procedure was repeated three times on different virus preparations to ascertain the accuracy of the UTRs.
7
Identification of 5'UTR Sequence Using RACE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To identify the 5'UTR, we used the rapid amplification of cDNA ends (RACE) kit (Invitrogen; San Diego, CA) on RNA isolated from HAECs according to the manufacturer’s instructions. Briefly, total RNA (5 µg) was dephosphorylated with 10 U/µl calf intestinal phosphatase (CIP) and treated with 0.5U/µl tobacco acid phosphatase (TAP) to removes the 5’ CAP structure. The 5’gene racer oligo was ligated to the RNA using T4 RNA ligase and the first strand cDNA was synthesized using random hexamers and superscript III RT. Transcripts were identified by PCR using the gene racer primer R1 and primers specific to the M region (M1: 5’GTGGGGGAGGTTTTATTT-3’) or bcl-2 open reading frame (ORF1: 5’CGCTGGGAGAACAGGGTACGATAA -3’). Amplification using nested racer primer R2 and gene-specific primers specific to the M region (M2: 5’-ATGACTGCTACGAAGTTCTCCC-3’) and the bcl-2 open-reading frame (ORF2: 5’-TGGCGCACGCTGGGAGAACA-3) were used to ensure specificity of products, followed by cloning into TOP10 vector (Invitrogen, CA) for sequencing.
8
Sanger Sequencing of PDCoV Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Attempts at next-generation sequencing using an Illumina MiSeq platform generated minimal coverage, so we sorted to Sanger Sequencing using the primer system outlined by Liang et al45 (link), with one addition: to obtain the 5′ ends of the viral genomes, a Rapid Amplification of cDNA Ends (RACE) kit was used per the manufacturer’s protocols (Life Technologies, Carlsbad, CA, USA), and the resulting amplicons TA-cloned into plasmids and sequenced. PCR amplicons for Sanger Sequencing were amplified using AccuScript High-Fidelity reverse transcriptase (Agilent Technologies, Inc., Santa Clara, CA) in the presence of SUPERase-In RNase inhibitor (Ambion, Austin, TX), followed by PCR with Q5 DNA polymerase (New England Biolabs. They were next purified using a QIAquick PCR purification kit (Qiagen Inc., Germantown, MD) before TA-cloning. The inserts in the plasmids were subsequently sequenced bidirectionally using a gene-walking approach, based on obtaining at least 800 bp or non-ambiguous sequence. Briefly, pairs of non-overlapping primers and Q5 polymerase were used to produce 42 separate amplicons corresponding to the PDCoV genome, and each amplicon was Sanger sequenced bidirectionally.
9
Sanger Sequencing of Porcine Deltacoronavirus Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Attempts at next-generation sequencing using an Illumina MiSeq platform generated minimal coverage, so we sorted to Sanger sequencing using the primer system outlined by Liang et al.42 (link), with one addition: to obtain the 5′ ends of the viral genomes, a rapid amplification of cDNA ends (RACE) kit was used per the manufacturer’s protocols (Life Technologies), and the resulting amplicons were TA-cloned into plasmids and sequenced. PCR amplicons for Sanger sequencing were amplified using AccuScript High-Fidelity reverse transcriptase (Agilent Technologies) in the presence of SUPERase-In RNase inhibitor (Ambion), followed by PCR with Q5 DNA polymerase (New England Biolabs). They were next purified using a QIAquick PCR purification kit (Qiagen) before TA cloning. The inserts in the plasmids were subsequently sequenced bidirectionally using a gene-walking approach, on the basis of obtaining at least 800 bp or non-ambiguous sequence. Briefly, pairs of non-overlapping primers and Q5 polymerase were used to produce 42 separate amplicons corresponding to the PDCoV genome, and each amplicon was Sanger sequenced bidirectionally.
10
Viral Genome Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Contigs and gaps were confirmed and filled by RT-PCR using specific primer pairs 1, 2, 3, 4, 1-2, 2-3, and 3-4 F/R (Table S1 ) designed according to the consensus sequences of the assembled viral contigs with more than 70-nt overlapping. The sugarcane yellow leaf virus (ScYLV, AF157029.1) genome sequence was used for the alignment and positioning of the contigs. The terminal sequences of the viral genome were obtained using 5′ and 3′ rapid amplification of cDNA ends (RACE) kits according to the manufacture (Invitrogen). The PCR products were collected using Wizard SV Gel and PCR Clean-Up System (Promega). The purified PCR products were then cloned into the pEASY-T5 vector (TransGen Biotech, China) and used to transformed Trans-T1 competent cells (TransGen Biotech) following the manufacturers' instructions. The clones harboring the transformed vector were identified by PCR and Sanger sequencing (Sangon Biotech (Shanghai) Co., China). The results of sequencing were assembled using DNAMAN (version 6) program (Lynnon Biosoft, San Ramon, CA, USA) with more than 70-nt overlapping regions to form the full-length viral genome.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!