Flag tag antibody

HEK293T cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences (Shanghai, China). ACHN and 786-O cells were provided by Shanghai GK Genentech Co., Ltd. (Shanghai, China). Cells freshly amplified and frozen were used every 2–3 months. They were routinely tested for the absence of mycoplasma contamination. Dulbecco’s modified Eagles medium (DMEM) high glucose medium and RPMI 1640 medium were purchased from Hyclone (Thermo Fisher Scientific, Inc.). Fetal bovine serum was purchased from Gibco (Thermo Fisher Scientific, Inc.). Transfection reagent Lipofiter™ was purchased from HanBio (Shanghai, China). TRIzol was purchased from Invitrogen (Thermo Fisher Scientific, Inc.). A complementary DNA (cDNA) kit was purchased from Fermentas (Thermo Fisher Scientific, Inc.), and a SYBR Green real-time polymerase chain reaction (PCR) kit was purchased from Applied Biosystems (Thermo Fisher Scientific, Inc.). ABAT and ALDH6A1 antibodies were purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). ACTIN antibody and Flag-tag antibody were purchased from Cell Signaling Technology (Danvers, MA, USA). A water-soluble tetrazolium salt (WST)-1 cell proliferation assay kit was purchased from Roche (Mannheim, Germany). Horseradish peroxidase (HRP)-tagged secondary antibody and ECL kits were purchased from Pierce (Thermo Fisher Scientific, Inc.).

Co-immunoprecipitation was performed as described previously [30 (link)]. Both the input and IP samples were analyzed by Western blot using various antibodies at the following dilutions: TRIM65 antibody (1:1000), RhoA antibody (1:1000), Flag-tag antibody (1:1000), HA-tag antibody (1:1000) and normal rabbit/mouse IgG (Cell Signaling Technology)

Co-immunoprecipitation was performed as described previously [45 (link)]. Both the input and IP samples were analyzed by Western blot using various antibodies at the following dilutions: FKBP14 antibody (1:1000), RhoA antibody (1:1000), Flag-tag antibody (1:1000), HA-tag antibody (1:1000) and normal rabbit/mouse IgG (Cell Signaling Technology).

Nucleofected SH-SY5Y cells (10⁵ cells/well) were plated on poly-L-lysine coated coverslips. After 21 h, cells were fixed with 4% paraformaldehyde solution for 10 min at room temperature and treated with 0.1% saponin solution for 10 min at room temperature. Then, the cells were blocked with 3% Bovine serum albumin and 0.1% saponin solution for 1 h at room temperature. Rabbit polyclonal katanin-p60 antibody in 1:100 dilution (ATLAS) and mouse monoclonal FLAG-Tag antibody in 1:400 dilution (Cell Signaling Technology) were prepared in blocking solution and incubated with the cells overnight at +4°C. Following day, Alexa Fluor 647 anti-rabbit and Alexa Fluor 488 anti-mouse secondary antibodies (Cell Signaling Technology) were incubated with the cells in 1:200 dilutions for 1 h at room temperature in dark. ProLong Diamond Antifade Mountant with DAPI (Invitrogen Corp., Carlsbad, CA, USA) was used for mounting of coverslips and Leica TCS SP2 SE Confocal Microscope (Buffalo Grove, IL, USA) was used for the visualization. All images were taken using 63X objective at zoom 2.6.

Breast cancer cell lines (T47D and MDA‐MB‐231) were purchased from American Type Culture Collection (ATCC). Cells were cultured as previously described.
²⁸ (link) Cells being transfected with the lentiviral stocks to stably express MEIS2 shRNA (Forward sequence: CCGGGAGCCAAGGAGCAG CATATAGCTCGAGCTATATGCTGCTCCTTGGCTCTTTTTG, Reverse sequence: AATTCAAAAAGAGCCAAGGAGCAGCATATAGCTCGAGCTATAT GCTGCTCCTTGGCTC), IL10 shRNA (Forward sequence: CCGGGCC TACATGACAATGAAGATACTCGAGTATCTTCATTGTCATGTAGGCTTTTTG, Reverse sequence: AATTCAAAAAGCCTACATGACAATGAAGATACTCGAG TATCTTCATTGTCATGTAGGC) or control shRNA (pLKO.1 empty vector) were cultured in DMEM supplemented with 10% FBS and 10 μg/mL puromycin. Cells stably expressing control vector (pcDNA), pcDNA‐MEIS2c, were cultured in DMEM containing 10% FBS and G418 (1000 μg/mL). Flag‐tag antibody and HA‐tag were purchased from Cell Signaling Technology.

Experiments were conducted using the following primary antibodies: Flag-tag antibody (Cell Signaling Technology, 8146 T, 1:1000 dilution), HA-tag antibody (Proteintech, 66006, 1:5000 dilution), caspase 3 antibody (Cell Signaling Technology, 9662 S, 1:1000 dilution), cleaved caspase 3 antibody (Cell Signaling Technology, 9661 S, 1:1000 dilution), cleaved PARP antibody (Cell Signaling Technology, 5625 S, 1:1000 dilution), β-actin antibody (Proteintech, 66009-1-Ig, 1:5000 dilution), Bax antibody (Cell Signaling Technology, 2772 S, 1:1000 dilution), BCL-2 antibody (Cell Signaling Technology, 15071, 1:1000 dilution), p53 antibody (Abcam, ab26, 1:1000 dilution) for p53-DBD, GST tag antibody (Cell Signaling Technology, 2625 S, 1:1000 dilution), and His-tag antibody (Abbkine, ABT2050, 1:5000 dilution). The secondary antibodies HRP-conjugated goat anti-mouse IgG (Abbkine, A21010, ATSDE1601, 1:2000 working dilution) and HRP-conjugated goat anti-rabbit IgG (Absin, abs20040, AS004, 1:2000 working dilution) were used. These antibodies were validated by western blotting according to the manufacturer’s website. Bands were visualized by enhanced chemiluminescence detection reagents (Vazyme, E411-04). Full blots have been included in the Source data file.