Sybr green pcr master mix reagent kit

The method of real-time quantitative PCR was used to validate the expression of 6 differentially expressed miRNAs and PDCD4 genes. The total RNA was converted to cDNA using the PrimeScript RT regent Kit (TaKaRa, Dalian, China). Random primers, oligo dT or miRNA-specific stem-loop primers were designed by us and used for the reverse-transcribed cDNA. RT-qPCR was performed using the SYBR Green PCR Master Mix Reagent Kit (TaKaRa, Japan), U6 was used for the normalization of miRNA data and β-actin was used for the normalization of the mRNA data. The RT-qPCR procedure was as follows: 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. The fold-change of the expression of the transcript mRNA or miRNA were analyzed using the 2^−ΔΔCt method. The RT-qPCR primers are listed in Table S8.

Gene expression was analysed by real-time polymerase chain reaction (PCR). To analyse the expression of vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1), total RNA from the cells in Regions ECA and CS was extracted by Trizol isolation, and cDNA was synthesized using the TaqMan reverse transcription (RT) Master Mix kit according to the manufacturer’s protocol. Real-time PCR analysis was performed with an Opticon Real-Time PCR Machine (Bio-Rad, CA, USA) using the SYBR Green PCR Master Mix Reagent Kit (Takara Biotechnology, Dalian, China). Each reaction mixture (total volume 20 μL) contained cDNA (equivalent to 100 ng RNA), 200 nM deoxyribonucleotides, each primer at 800 nM and 0.5 U GoTaq polymerase (Biotools B&M Labs, Madrid, Spain). The cycling conditions were as follows: incubation for 3 min at 95 °C followed by 35 cycles of 95 °C for 30 s, 55 °C for 45 s and 72 °C for 45 s.
The relative quantitation of the gene expression was determined by the ^ΔΔCT method, and GAPDH was used as a control. For these analyses, we used the specific primers shown in ST 1.

Quantitative real-time polymerase chain reaction (PCR) was performed to determine whether AC regulated the mRNA expression of iNOS, COX-2, TNF-α, IL-1β, and IL-6 in RAW 264.7 cells following exposure to LPS (100 ng/mL) for 3 h. RAW 264.7 murine macrophages were pretreated with AC at different concentrations for 2 h before stimulation with 100 ng/mL LPS. After the incubation for an additional 3 h, total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, United States), then quantified, and reverse-transcribed to cDNA. Relative quantitation of expression of the selected genes was performed in a LightCycler 480 system (Roche, Pleasanton, CA, United States) using a SYBR Green PCR master mix reagent kit (Takara, Dalian, China) and the PCR primers shown in Table 1. The cycling conditions were 95°C for 30 s, followed by 40 cycles of 95°C for 10 s, 57°C for 10 s, and 72°C for 10 s. A dissociation curve was generated in a cycle of 95°C for 5 s, 67°C for 1 min, and 97°C for 15 s. The mRNA expression levels were determined relative to the blank control after normalization to the GAPDH level using the 2^-ΔΔC_t method. Analysis was carried out in triplicates. Control cells were grown under identical conditions without AC and LPS. In addition, RAW 264.7 cells were incubated under identical conditions in the absence of LPS with AC (40 μM) alone.

RAW264.7 cells were seeded in plates with six cells at 1 × 10⁶ cells/well in RPMI 1640 complete medium, and cultured overnight in a humidified incubator with 5% CO₂ at 37°C. Cells were then treated with 500 ng/ml LPS and indicated three concentrations of SOG (25, 50, 100 μM) for 1 or 6 h. After removing media, 300 μl TRIzol reagent was added to each well to lyse cells. The extraction of RNA was conducted on the basis of the instructions of producers, along with the transcription of RNA samples into cDNA employing Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Germany). In ABI 7500 real-time PCR system (Applied Biosystems, Carlsbad, CA), SYBR Green PCR master mix reagent kit (Takara, Dalian, China) was used to measure the mRNA level of the selected gene. The primers used for PCR are as follows: TNF-α: 5′-GGCTCCAGGCGGTGCTTGTT-3′ and 5′-GGCTTGTCACTCGGGGTTCG-3′; IL-6: 5′-GGATACCACTCCCAACAGACC-3′ and 5′-TCCAGTTTGGTAGCAT CATCA-3′; β-actin: 5′-GATCAAGATCATTGCTCCTCCTG-3′ and 5′-AGGGTGTAAAACGCAGCTC. The calculation of relative quantity of genetic expression was achieved on the basis of the formula below: 2^−△△Ct, where △Ct = [Ct (gene) Ct (β-actin)] and Ct is the crossing threshold value of each gene amplification returned by the PCR.

Primary OBs were treated with vehicle alone, ALA (1 μM, 10 μM, or 100 μM) or PA 0.2 mM or (PA 0.2 mM + ALA 1 μM) or (PA 0.2 mM + ALA 10 μM) or (PA 0.2 mM + ALA 100 μM) for 3 days. Total RNA was extracted from OBs using TRIzol (Takara Biotech, Dalian, China) according to the manufacturer’s protocol. cDNA was obtained from 1 μg of total RNA, and RT-qPCR was carried out using the SYBR Green PCR Master Mix reagent kit (Takara Biotech, Dalian, China). The primer sequences used are listed in Table 2. PCR products were subjected to a melting curve analysis, and the relative expression was calculated for each gene by the 2^-∆∆CT method, using β-actin for normalization. β-Catenin, RUNX2, and osterix mRNA (Takara Biotech, Dalian, China) expression levels were examined on day 3 after different treatments. Each sample was measured at least in triplicate.
Table 2

Primer sequences used for the determination of gene expression

Gene(Rats)	Primer sequence((5′ - 3′)	Product bp
β-catenin	Forward CATCACCACGCTGCATAATC	156
	Reverse GAGCTTGCTTTCCTGATTGC
RUNX2	Forward CATGGCCGGGAATGATGAG	148
	Reverse TGTGAAGACCGTTATGGTCAAAGTG
os0074erix	Forward CACCCATTGCCAGTAATCTTCGT	97
	Reverse GGACTGGAGCCATAGTGAGCTTCT
β-actin	Forward ACCCAGATCATGTTTGAGAC	99
	Reverse GTCAGGATCTTCATGAGGTAGT

β-catenin, catenin beta1; RUNX2, runt-related transcription factor 2; osterix, Sp7 transcription factor; β-actin, actin, beta

Real-time PCR was performed for the selected upregulated and downregulated genes to verify RNA-seq results. A cDNA synthesis reaction was performed using a mixture of AccuPower PCR PreMix (Bioneer, Daejeon, Korea) and water. The cDNA was synthesized from total RNA obtained from both groups using the SuperScript First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA) and was amplified with an ABI-7300 (Applied Biosystems, Mortlake, Waltham, Massachusetts, USA). The amplified cDNA was detected with SYBR Green PCR Master Mix Reagent Kit (Takara, Seoul, Korea). PCR conditions were as follows: incubation for 10 min at 95 °C, followed by 40 cycles of 10 s denaturation at 95 °C, and annealing for 60 s at 60 °C. The reaction mixture lacking cDNA was used as a negative control in each run. Primer sequences are summarized in Table 1. Ratios of the intensities of the target genes and GAPDH signals were used as a relative measure of the expression level of the target genes. To ensure accuracy of the experiments, primer specificity was confirmed by the dissociation curve after PCR, and real-time PCR assays were performed in triplicate for each sample. The mean fold-change in expression in the experimental group compared with the control group was calculated from the △△Ct values, and the range of the fold-changes was represented by standard deviations of the values [21 (link)].

Total RNA, extracted from cancer cell lines and tissue samples using TRIzol Reagent (Invitrogen, Carlsbad, CA), was reverse transcribed using a PrimeScript RT reagent Kit (TaKaRa, Shanghai, China). Resultant complementary DNAs (cDNAs) underwent quantitative real-time reverse transcriptase PCR using a SYBR Green PCR Master Mix Reagent Kit (TaKaRa). Real-time PCR and data collection were performed on an ABI 7500 real-time system (Applied Biosystems). The primers for SDHB were 5'- AAA TGT GGC CCC ATG GTA TTG-3' (forward) and 5'-AGA GCC ACA GAT GCC TTC TCT G-3' (reverse). The primers for β-actin, serving as the endogenous controls, were 5'-TGA CGT GGA CAT CCG CAA AG-3' (forward) and 5'-CTG GAA GGT GGA CAG CGA GG-3' (reverse). SDS v.1.4 (Applied Biosystems) software was used to perform comparative delta cycle threshold (Ct) analysis. To minimize random variation in cell experiments, each real-time PCR experiment was performed in triplicate.