RNA from whole CNS and spleen was homogenized in trizol (Invitrogen; Carlsbad, CA) and isolated following the manufacturer’s instructions. Precipitated RNA was resuspended in THE RNA Storage solution (Invitrogen) and treated with rDNAse I (Invitrogen). Complementary DNA was generated with the high capacity cDNA reverse transcription kit using the random hexamer primer protocol (Invitrogen). Quantitative real-time PCR was performed on an ABI PRISM 7000 System (Applied Biosystems; Foster City, CA) using SYBR® Green detection (Invitrogen). Primers for APOE (5’ CGCAGG TAATCCCAGAAGC 3’) and (5’CTGACAGGATGCCTAGCCG 3’) along with 18s rRNA (5’ TTCGGAACTGAGGCCATGATT 3’) and (5’ TTTCGCTCTGGTCCGTCTTG 3’) were obtained from IDT (Coralville, IA). The relative quantitation (RQ) value was calculated using the ΔΔCt method with 18s as the internal control.
Rdnase 1
Manufactured by Thermo Fisher Scientific
Sourced in United States
RNase I is an enzyme that cleaves single-stranded RNA. It is commonly used in molecular biology applications to remove RNA from DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Improm 2 reverse transcription system, by Promega (2 mentions)
Brilliant 3 ultra fast sybr green qpcr master mix, by Agilent Technologies (2 mentions)
Dynabead, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Abi prism 7000 system, by Thermo Fisher Scientific (1 mentions)
Sybr green detection, by Thermo Fisher Scientific (1 mentions)
The rna storage solution, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Power sybr green, by Thermo Fisher Scientific (1 mentions)
Stepone plus thermal cycler, by Thermo Fisher Scientific (1 mentions)
Multiscribe reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rnaqueous total rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Hiseq 4000, by Illumina (1 mentions)
17 protocols using rdnase 1
1
Quantitative Real-Time PCR Analysis of APOE
2
Quantitative RT-PCR for Differential Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from control or hypergravity stimulated seedlings as described above and treated with rDNase I (DNAfree, Invitrogen, Waltham, MA, USA). First-strand cDNA was synthesized with random hexanucleotide primers and Multiscribe reverse transcriptase according to manufacturer’s specifications (Applied Biosystems, San Francisco, CA, USA). Quantitative reverse transcription PCR (qRT-PCR) reactions were prepared with a master-mix (Power SYBR Green, Applied Biosystems, San Francisco, CA, USA) and carried out in triplicate using cDNA equivalent to 20 ng of RNA input. Transcript abundances of the genes of interest were quantified using gene specific primers and PP2A as an endogenous control (Sequences of primers used in this study are shown in Table S3 ). All qRT-PCR reactions were carried out in a StepOnePlus thermal cycler (Applied Biosystems, San Francisco, CA, USA) and relative expression values were calculated according to the ΔΔCT method [27 (link)] by instrument software (StepOne v2.2.2).
3
RNA Isolation and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the Invitrogen™ RNAqueous™ Total RNA Isolation Kit, with the addition of a DNase step (Invitrogen rDNase I) to remove genomic DNA contamination. Extracted total RNA was quantified on Denovix spectrophotometer and ran on a 1% agarose gel to visualize RNA integrity. RNA quantities were normalized and sent to NovoGene where libraries were prepared for RNAseq using poly-A capture and cDNA synthesis and amplification. Resulting libraries were sequenced on an Illumina HiSeq4000 with 150 bp paired-end reads. Sequencing depth ranged from 9.8 to 13.3 million reads per sample, with average quality ranging from 40 to 42.
4
Oyster Tissue DNA and RNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oyster pools and dead oysters were homogenized by bead-beading (Retsch, Mixer Mill MM400) with a stainless steel ball bearing and housing that had been pre-chilled with liquid nitrogen. Genomic DNA was purified from homogenised oyster tissues using UltraPure Phenol:Chloroform:Isoamyl Alcohol (Invitrogen, #15593-049). Total RNA was purified using TRIzol Reagent (Invitrogen, #15596-018) and DNA contamination eliminated with rDNase I (Ambion, #AM2222). Total RNA and DNA were resuspended to a final concentration of 100 and 20 ng µL−1, respectively. First-strand synthesis was performed on 500 ng of total RNA using random hexamer primers (Invitrogen, #48190-011) and M-MLV (Invitrogen, #28025-013). cDNA was diluted 10-fold with sterile water (DNase- and RNase-free) prior to use.
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was carried out as previously described (Sun et al., 2011 (link)). Briefly, cells were first grown in LB broth overnight before diluting to an OD600 of 0.05 in LB and incubating at room temperature to an OD600 of 0.8. Total RNA was isolated using the Rneasy Mini Kit (Qiagen). Residual DNA was removed by treatment with rDNase I (Ambion) and confirmed by PCR. cDNA was synthesized from the RNA and used for quantitative PCR on an Applied Biosystems unit (Quant Studio 5). The quantity of mRNA was normalized relative to the reference gene 16sRNA (YP_r1). The relative mRNA expression levels in each strain were normalized to the wild type samples. Primers and probe sets used in this study are listed in Supplementary file 3 . Results from three independent experiments performed in technical triplicate were analyzed by one-way analysis of variance (ANOVA) with Bonferroni’s test.
6
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was performed as described above. Purified RNA samples were further treated with rDNase I (Ambion) to ensure the complete removal of contaminating DNA, and re-purified using the RNeasy Mini Kit (Qiagen) RNA cleanup protocol. First-strand cDNA synthesis was performed using the SuperScript® III First-Strand Synthesis System (Invitrogen) as per manufacturer’s recommendation. Real-time PCR was performed using SYBR® Green PCR Master Mix (Applied Biosystems) on a ViiA™ 7 Real-Time PCR System (Applied Biosystems), using the following primers for sslE, primers 4205 and 4206. Transcript levels of each gene were normalized to gapA as the endogenous gene control (primers 820 and 821). Gene expression levels were determined using the 2-ΔΔCT method [60 (link)], with relative mRNA fold-difference expressed against the respective wild-type strains. All experiments were performed as three independent replicates, with all samples analyzed in triplicate. Statistical analysis of fold differences from wild-type, mutant and complemented strains was performed using an unpaired, two tailed student’s t-test.
7
Isolation and Analysis of Glomerular RNA
8
Quantitative Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was carried out as previously described10 (link). Briefly, cells were grown in LB broth overnight and diluted to OD600 0.05 and grown in LB broth at room temperature to OD600 about 0.8. Total RNA was isolated from collected cells using the RNeasy Mini Kit (Qiagen). Residual DNA was removed by treatment with rDNase I (Ambion) and confirmed by PCR. cDNA was synthesized from the RNA and used for quantitative PCR on an ABI Prism 7900 Sequence Detection System (Taqman, Applied Biosystems). The quantity of mRNA was normalized relative to the quantity of the reference gene crr (y1485)40 (link). The ratio of the normalized quantity of hmsD mRNA in different strains to the normalized quantity in the wild-type samples was calculated. Primers and probe sets used are listed in Supplementary Table S2 . Results from three independent experiments done in triplicate were analyzed by one-way ANOVA with Bonferroni's test.
9
Trichoderma Transcriptomic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The different Trichoderma strains were grown on PDA plates overlaid with a sterile cellophane sheet, incubated for 3 days at 28°C, and mycelia were harvested for total RNA extraction using TRIzol Reagent (Invitrogen), as described by the manufacturer. Briefly, 2 μg of total RNA was treated with rDNase I (Ambion) and reverse-transcribed to cDNA with SuperScript II Reverse Transcriptase (Invitrogen) using oligo-dT primer. The synthesized cDNAs concentration were checked in a Nanodrop spectrophometer (Thermo Scientific) and used as template for real time RT-PCR.
10
Diaphragm Muscle Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from a frozen section of diaphragm muscle using Eurogold trifast reagent (Euroclone S.p.A., Pero, Milano, Italy) according to the kit protocol, and quantified using a NanoDrop 1000 spectrophotometer (ThermoScientific, Waltham, MA, USA). Then, 1000 ng of total RNA were incubated with rDNase I (Ambion, Austin, TX, USA) for 20 min at 37 °C to digest contaminating genomic DNA. Further, 400 ng of total digested RNA of each sample were reverse transcribed to cDNA using M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). cDNA was amplified by PCR using GoTaq G2 DNA polymerase (Promega, Milano, Italy) with an Applied Biosystems 7900HT Fast Real-Time PCR System. MuRF-1, atrogin-1, and myogenin were assayed using probe sequences Taqman® Gene Expression Assay (MuRF-1: Fbxo-32 Rn00591730_m1, Atrogin-1: Trim63 Rn00590197_m1, Myogenin Rn01490689_g1, β–actin Rn00667869_m1). Gene expression was measured by the ΔΔCT method and was normalized to β-actin mRNA levels. Data are shown as the fold change of the gene of interest relative to that of control animals.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!