Td 06415

Eight-week-old male mice, C57BL/6N from Charles River (Wilmington, MA) and C57BL/6J and C3H/HeJ mice from Jackson Labs (Bar Harbor, ME), were obtained (n = 30 mice/strain) for these studies. Animals were acclimated for 7 days and then randomly assigned to a control AIN-93M (10% kcals from fat) or a HF (45% kcals from fat; Harlan Teklad, TD.06415) diet for 24 wk. Body weight and food intake were recorded throughout the study. Total feed efficiency was calculated by determining the gain in body weight (mg) per energy unit consumed (kcal) [35 (link)]. Venous tail blood was collected following a 6 hr fast for evaluation of glucose and insulin at 4 wk intervals. After 24 wk, mice were anesthetized (ketamine/xylazine cocktail 70 and 30 mg/kg body weight, resp.) as previously reported and whole body DXA (Lunar PIXI, GE Medical Systems, Madison, WI) scans were performed. Mice were exsanguinated via the carotid artery. An aliquot of blood was collected for total white blood cell (WBC) counts and the remainder processed for plasma in EDTA coated tubes and stored at −80°C. All procedures were approved by the Institutional Animal Care and Use Committee of Oklahoma State University.

All mice were housed in a controlled temperature (20°C–22°C) and light (14-hour light/10-hour dark) vivarium during these studies. ACOT1 heterozygous KO mice were purchased from the NIH Knockout Mouse Project (VG12838), which uses VelociGene’s KOMP Allele Genotyping Strategies (Figure 1A). Next, heterozygous mice were bred together to generate mice with homozygous whole-body ACOT1KO. To confirm ACOT1 KO) via PCR, DNA was isolated from tail clips using DNeasy blood and tissue kit from QIAGEN and genotyped based on PCR protocols provided by the NIH Knockout Mouse Project using primers to identify the gene (TDF: AAGGATGAGACTATACCCCCTGTGA and SDR: ACTTCGGGAGGGAAGATGAG) and for the cassette (SUF: GTCAAAGACTGCCGGCTAAG and LacZRev: GTCTGTCCTAGCTTCCTCACTG), which indicates the absence of the ACOT1 gene (Figure 1B). Mice had free access to water and food, and at 8 weeks of age, ACOT1KO or littermate WT mice were switched to either a purified LFD (TD.94045) or a 45% HFD (TD.06415) from Harlan Teklad for 12 weeks. ACOT1 is highly active in most tissues during fasting (8 (link)); thus, mice in this study were fasted overnight for approximately 16 hours before sacrifice.

C57BL/6J db/db mice are mice in “C57 black 6 genetic background” with db/db
mutation (genetic mutation with defective leptin receptor), which develop
obesity and T2DM. C57BL/6J db/db female mice (2 months old) were purchased from
the Animal Research Center of Nanjing University (China) and kept in a
pathogen-free facility and maintained under a 12-h light/dark cycle at 22°C.
Mice were fed with a high-fat diet (HFD) (19% protein, 36% carbohydrate, and 45%
fat; Harlan-Teklad TD.06415, USA). At the 10th week of feeding, mice were
randomly divided into si-NC group and si-P4HA3 group. sh-P4HA3 group mice were
intraperitoneally injected with adeno-associated virus carrying P4HA3 shRNA
(AAV-shRNA-P4HA3), while sh-NC group mice were injected with AAV-scrambled
shRNA. At the 20th week of feeding, the mice were sacrificed after 4-h fasting.
Animal care and experimental procedures were approved by the Ethics Committee in
Animal Experimentation of the First Affiliated Hospital of Bengbu Medical
College (China).