Genomic mini ax stool spin kit

We used 20 fecal samples taken from rats while running another project (“The effects of ligands of the alpha7 nicotinic acetylcholine receptors on complex cognitive processes and social behavior in the neurodevelopmental schizophrenia-like model”, project grant no 014/15/N/NZ7/02978 supported by National Science Centre, approval of the 2nd Local Institutional Animal Care and Use Committee in Krakow, no 1198/2015) on gut microbiota in a rat model of schizophrenia. Samples were collected in polypropylene tubes (FL Medical, Padova, Italy) and immediately frozen at − 80 °C pending further analysis, for no longer than 2 months. Bacterial DNA was isolated according to our previous works using mechanical, chemical, and enzymatic lysis of microbial cells and commercial Genomic Mini AX Stool Spin kit (A&A Biotechnology, Gdansk, Poland) (Gosiewski et al. 2014 (link); Sroka-Oleksiak et al. 2020 (link); Krawczyk et al. 2021 (link)). The concentration and purity of DNA isolates were determined spectrophotometrically for the A260 nm and A260nm/280 nm ratio using NanoDrop (Thermofisher, Waltham, MA USA).

A detailed DNA isolation protocol was presented in our team’s previous studies^{16 (link)}. The frozen samples were thawed, precisely weighed (about 0.1 g of stool sample was used) and homogenized in 0.1 ml of saline. After lysis of bacterial and fungal cells with lysozyme (Sigma-Aldrich, Poznań, Poland) (1 mg/ml) and lysostaphin (Sigma-Aldrich, Poznań, Poland) (0.1 mg/ml), samples were incubated at 37 °C for 20 min. Next, 200 μl 75 mM NaOH (Avantor Performance Materials, Gliwice, Poland) was added and samples were incubated at 95 °C for 10 min. After incubation, probes were microcentrifuged (12 000 rpm, 10 min), supernatants were removed, and pellets were resuspended in 500 μl buffer supplemented with β-mercaptoethanol (Sigma-Aldrich, Poznań, Poland). For each sample, lyticase (Sigma-Aldrich, Poznań, Poland) was added (0.1 mg/ml). Probes were incubated at 37 °C for at least 30 min and microcentrifuged (12 000 rpm, 10 min). The next steps of DNA extraction were carried out according to Genomic Mini AX Stool Spin Kit (A&A Biotechnology, Gdańsk, Poland) procedure.
DNA concentration and purity was controlled spectrophotometrically using a NanoDrop apparatus (Thermo Fisher Scientific).

At the Department of Microbiology JUMC, Kraków, Poland, fungal DNA was isolated from 76 stool samples using the Genomic Mini AX Stool Spin kit (A&A Biotechnology, Gdańsk, Poland) with the application of a preliminary procedure, as described by us earlier [15 (link),21 (link)].
The next step involved the creation of an amplicon library of the whole ITS regions of the fungal rDNA gene cluster for each sample tested (Figure 1).
Since, as stated above, the mycobiome constitutes only 0.1% of the whole gut microbiome [9 (link),11 (link),12 (link)], some of the fecal samples did not demonstrate the presence of fungal genetic material. In order to solve this problem, we employed the nested method (according to the developed protocol—Table 1) to prepare genetic libraries of ITS in order to increase the sensitivity and specificity of the amplified fragments. To exclude the possibility of obtaining a PCR signal from potential contamination, a control was employed in the form of water, which was also subjected to amplification using the nested PCR technique.
The Illumina overhang adapter sequences: F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG, were added to the 5′ end of the internal primers. Subsequently, the protocol for the MiSeq high-throughput sequencer (Illumina, San Diego, CA, USA) was followed [22 ].