Qtower g3 cycler

To quantify genomic copies in oropharyngeal swabs and 25 mg homogenized lung tissue, RNA was extracted using innuPREP Virus DNA/RNA kit (Analytic Jena) according to the manufacturer’s instructions. qPCR was performed using the NEB Luna Universal Probe One-Step RT–qPCR kit (New England Biolabs) with cycling conditions of 10 min at 55 °C for reverse transcription, 3 min at 94 °C for activation of the enzyme, and 40 cycles of 15 s at 94 °C and 30 s at 58 °C on a qTower G3 cycler (Analytic Jena) in sealed qPCR 96-well plates. Primers and probes were used as previously reported⁵⁷ . Oligonucleotides (Sequence (5’-3’)): E_Sarbeco_F: ACAGGTACGTTAATAGTTAATAGCGT;
E_Sarbeco_R: ATATTGCAGCAGTACGCACACA;
E_Sarbeco_P1: FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ.

To extract RNA from lung tissue, 25 mg of lung tissue was first homogenized in a bead mill (Analytic Jena). RNA was isolated from oral swabs, oropharyngeal swabs, and the homogenized lung tissue using the innuPREP Virus DNA/RNA Kit (Analytik Jena, Jena, Germany). Total SARS-CoV-2 RNA was quantified by quantitative reverse transcription PCR (RT-qPCR), employing the forward primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT), the reverse primer E_Sarbeco_R2 (ATATTGCAGCAGTACGCACACA), and the probe E_Sarbeco_P1 (FAM-ACACTAGCCATCCTTACTGCGCTTCG/ZEN/-IBFQ), which targeted the E gene region of SARS-CoV-2⁴⁵ . Subgenomic SARS-CoV-2 RNA transcripts were quantified using the same assay, except that the forward primer was substituted with the primer sgLeadSARSCoV2 (CGATCTCTTGTAGATCTGTTCTC), which targeted the leader sequence of the SARS-CoV-2^{16 (link)}. The assay was performed on a qTower G3 cycler (Analytik Jena) using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) and the following cycling conditions: 10 min at 55 °C for reverse transcription, 3 min at 94 °C for activation of the polymerase and 40 cycles of 15 s at 94 °C and 30 s at 58 °C.

RNA was extracted from oropharyngeal swabs and 25 mg homogenized lung tissue using innuPREP Virus DNA/RNA Kit (Analytic Jena, Jena, Germany) according to the manufacturer’s instructions. NEB Luna universal Probe One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA, United States) was used to perform qPCR with cycling conditions of 10 min at 55°C for reverse transcription, 3 min at 94°C for activation of the enzyme, and 40 cycles of 15 s at 94°C and 30 s at 58°C on a qTower G3 cycler (Analytic Jena, Jena, Germany) in sealed qPCR 96-well plates. To monitor virus growth, SARS-CoV-2 RNA was quantified in cell culture supernatants by RT-qPCR targeting the SARS-CoV-2 E gene, as described previously (Corman et al., 2020 (link)).