E_Sarbeco_R: ATATTGCAGCAGTACGCACACA;
E_Sarbeco_P1: FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ.
The QTower G3 cycler is a real-time PCR (polymerase chain reaction) instrument designed for nucleic acid amplification and detection. It features a compact and robust design, providing a reliable platform for various molecular biology applications.
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!