Total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Total RNA (1 µg) was reverse-transcribed to cDNA using an AccuPower RT PreMix kit (Bioneer Corporation, Daejeon, Korea), with incubations performed at 37°C for 15 min followed by 85°C for 10 sec. Gene specific primers for the 20 mRNAs and β-actin are summarized in Table I , β-actin served as an internal control for gene expression normalization. PCR amplifications were performed using Takara master mix (Takara Biotechnology Co., Ltd., Dalian, China). For each PCR, 1 µl template cDNA, equivalent to ~100 ng total RNA, was mixed with 12.5 µl 2X SYBR-Green PCR Master mix and 0.4 µM each of the forward and reverse primers in a final volume of 20 µl under the following conditions: Initial enzyme activation at 95°C for 10 min, amplification for 40 cycles (95°C for 30 sec and 60°C for 60 sec), followed by a dissociation curve analysis. The relative RNA level was calculated using the 2ΔΔCq method (9 (link)).
Takara master mix
Manufactured by Takara Bio
Sourced in Japan
TaKaRa Master Mix is a pre-mixed solution containing all the essential components required for PCR (Polymerase Chain Reaction) amplification. It includes the DNA polymerase, dNTPs, buffer, and other necessary reagents, allowing for easy and efficient DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Sybr green master mix, by Thermo Fisher Scientific (3 mentions)
Steponeplus, by Thermo Fisher Scientific (2 mentions)
Accupower rt premix kit, by Bioneer (1 mentions)
Steponeplus instrument, by Thermo Fisher Scientific (1 mentions)
2 step kit, by Takara Bio (1 mentions)
Sybr premix ex taq master mix, by Takara Bio (1 mentions)
5 protocols using takara master mix
1
Real-time qRT-PCR for Gene Expression
2
RNA Extraction and qPCR Analysis of Mouse Brain Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from brain tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, U.S.A.). Reverse transcription (RT) of total RNA was carried out using TaKaRa Master Mix (TaKaRa, Japan). The primers were purchased and validated from Generay (Shanghai, China). Real-time PCR was carried out using SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus instrument (Applied Biosystems). The primers used for qPCR were as follows:
OXTR (F): CTCCCACCTATTTCTACTACC
OXTR (R): TCATTTCCCACTCCTTGTC
ENSMUSG00000090031 (F): CTGATGTTTGCCATAAAGAG
ENSMUSG00000090031 (R): AGTTAGGGAAGACAATGAAG
ENSMUSG00000087563 (F): GCCGTGATCTTGGGTTTG
ENSMUSG00000087563 (R): GCGACGATCTCGACTTTG
ENSMUSG00000104674 (F): CCCTTCAACTCCTTGGGTCC
ENSMUSG00000104674 (R): CCCAGGCTGGTGATTTCAGT
ENSMUSG00000109754 (F): TAGGCAAGAACTTCACGGTAG
ENSMUSG00000109754 (R): CTCTTTGTATGCCTGCGAATC
ENSMUSG00000045238 (F): TCGCATCAGTGCTGTGAAGT
ENSMUSG00000045238 (R): CGTCTTTCACGTGGATCCCT
GAPDH (F): CTGCCCAGAACATCATCC
GAPDH (R): CTCAGATGCCTGCTTCAC
3
Quantitative Analysis of SIRT2 and microRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared using TRIZOL reagent (Invitrogen Life Technologies, United States). Reverse transcription of total RNA using TaKaRa Master Mix (TaKaRa, Japan). The primers were purchased from GENEray (Shanghai, China). Real-time qPCR was carried out using SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus instrument (Applied Biosystems). The primers used for qPCR were as follows: SIRT2 (sense 5′-CCTCCTTGCAGGGACGTGG-3′, antisense 5′-GCTGTCACTGGGGTTTCTCC-3′); GAPDH (sense 5′-AATGGGCAGCCGTTAGGAAA-3′, antisense 5′-GCGCCCAATACGACCAAATC-3′). MicroRNA specific primers were purchased from GeneCopoeia. The relative expression was calculated using the ΔCT method as described elsewhere and normalized to uniformly expressed U6. All qRT-PCRs were performed in triplicates, and the data are presented as mean ± standard error (SEM).
4
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells was isolated by Trizol reagent (Thermo Scientific™, Waltham, Massachusetts, USA) and reverse transcription of total RNA was carried out using TaKaRa Master Mix (TaKaRa, Japan). Quantitative RT-PCR was carried out using SYBR Premix Ex Taq Master Mix and a 2-Step kit (TaKaRa, Dalian, China). The PCR conditions were carried out according to the manufacturer's instructions. The Ct values were normalized to that of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene. The ΔΔCt method was used to determine the relative expression level of the target genes. The primers used in this research were listed in Table S1.
5
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription of total RNA was carried out using TaKaRa Master Mix (TaKaRa, Japan). The primers were purchased and validated from Genescript (Nanjing, China). Real-time qPCR was carried out using SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus instrument (Applied Biosystems). qPCR primers were designed using a primer design tool, and the sequences were in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!