Ptrchis topo ta expression kit
The PTrcHis TOPO® TA Expression Kit is a laboratory equipment product that enables the direct cloning and expression of Taq polymerase-amplified PCR products in E. coli. The kit includes the necessary components to facilitate this process, including the pTrcHis TOPO® vector and competent E. coli cells.
Lab products found in correlation
3 protocols using ptrchis topo ta expression kit
CnYPD1 Gene Constructs and Mutations
Cloning and Expression of β-Lactamase Genes
blaOXA-1, blaOXA-9, blaOXA-48, , blaKPC-2, blaTEM-1, and blaDHA-1 β-lactamase genes were cloned using pTrcHis TOPO® TA Expression Kit (Life Technologies, Prague, Czech Republic) according to the manufacturer’s recommendations. Oligonucleotides for the PCRs followed by cloning were as follows: blaOXA-1, forward: ATGAAAAACACAATACATATCAACTTCG, reverse: TTATAAATTTAGTGTGTTTAGAATGGTG; blaOXA-9, forward: ATGAAAAAAATTTTGCTGCTGCATATG, reverse: CACATATCATTTGTTACCCATC; blaOXA-48, forward: ATGCGTGTATTAGCCTTATC, reverse: CTAGGGAATAATTTTTTCCT; blaDHA-1, forward: GTTTGTTCTGTCCGG, reverse: TTATTCCAGTGCACTCA; blaTEM-1, forward: ATGAGTATTCAACATTTCCGT, reverse: TTACCAATGCTTAATCAGTGA; blaKPC-2, forward: ATGTCACTGTATCGCC, reverse: GATTTTCAGAGCCTTAC. Plasmids were isolated using the Qiagen Plasmid Maxi Kit (Qiagen GmbH, Hilden, Germany) and chemically transformed to E. coli ATCC25922 competent cells prepared by the method described by Fournet-Fayard et al. (1995 (link)). Transformants were selected on Mueller-Hinton agar containing 50 mg/L of ampicillin.
Protein Expression and Purification Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!