PCR products were resolved using a 2% agarose gel stained with 0.5 μg/mL ethidium bromide electrophoresis. The digital images were then analysed with a Gel Dock (VILBER, France). Gel photographs were scored by visual comparison of DNA fragments for individual samples and estimated using 100 base pair (bp) DNA ladder marker (Promega Corporation, USA). A sample was considered positive if a 205 bp product was detected for P. falciparum and 412 bp detected for P. malariae.
Dna ladder marker
Manufactured by Promega
Sourced in United States
DNA Ladder Marker is a DNA size standard used to determine the size of DNA fragments in gel electrophoresis. It contains a mixture of DNA fragments of known sizes that can be used as a reference to estimate the size of unknown DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Wizard sv clean up system, by Promega (3 mentions)
Abi prism 3730, by Thermo Fisher Scientific (2 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Sequencher tmv 4.1.4 software for pc, by Gene Codes (1 mentions)
Abiprism 3130 genetic analyzer automated sequencer, by Thermo Fisher Scientific (1 mentions)
6 protocols using dna ladder marker
1
Molecular Diagnosis of Malaria Parasites
2
MLEE and HSP70 Sequencing for Leishmania Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All samples from CLIOC are typed by Multilocus Enzyme Electrophoresis (MLEE) following the internal Standard Operational Procedures (SOPs). Additionally, for the present work, the HSP70 PCR products of the selected strains were obtained and sequenced, as previously reported [11 (link)], as an additional method to identify the species and reveal the polymorphisms within the region analyzed by HRM. The DNA sequencing of the HSP70 genomic region was performed by Fiocruz facilities. Briefly, PCR products were purified with the Wizard SV Clean-up System (Promega, Madison, WI, USA). The final DNA concentration was estimated by comparison with a DNA Ladder Marker (Promega, Madison, WI, USA) in a 1.5% agarose gel. Sequencing was performed with the same primers used for amplification using the BigDyeTerminator v3.1 Cycle Sequencing Kit, and the products were analyzed in an automated DNA sequencer (ABI PRISM-3730—Thermo Fisher Scientific, Waltham, MA, USA). Consensus sequences were generated from forward and reverse strands using the Phred-Phrap-Consed package [34 (link)]. Only sequences with Phred values above 20 were used for contig construction.
3
MLEE and HSP70 Sequencing for Leishmania Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All samples from CLIOC are typed by Multilocus Enzyme Electrophoresis (MLEE) following the internal Standard Operational Procedures (SOPs). Additionally, for the present work, the HSP70 PCR products of the selected strains were obtained and sequenced, as previously reported [11 (link)], as an additional method to identify the species and reveal the polymorphisms within the region analyzed by HRM. The DNA sequencing of the HSP70 genomic region was performed by Fiocruz facilities. Briefly, PCR products were purified with the Wizard SV Clean-up System (Promega, Madison, WI, USA). The final DNA concentration was estimated by comparison with a DNA Ladder Marker (Promega, Madison, WI, USA) in a 1.5% agarose gel. Sequencing was performed with the same primers used for amplification using the BigDyeTerminator v3.1 Cycle Sequencing Kit, and the products were analyzed in an automated DNA sequencer (ABI PRISM-3730—Thermo Fisher Scientific, Waltham, MA, USA). Consensus sequences were generated from forward and reverse strands using the Phred-Phrap-Consed package [34 (link)]. Only sequences with Phred values above 20 were used for contig construction.
4
Multiplex PCR for Shiga Toxin Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was performed using 2 mL of template in a 20 mL volume of the PCR PreMix (Promega corporation). The PCR mixture consisted of 1 U thermostable DNA polymerase, 250 mM dNTP, 50 mM Tris-HCl (pH 8.3), 40 mM KCl, and 1.5 mM MgCl2. PCR was carried out in a gene thermal cycler (Bio-Rad, Tokyo, Japan). The optimized cycle program of denaturation, annealing, and extension temperatures was as follows: 1 cycle of 2 min at 94°C; 35 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C; and 1 cycle of 5 min at 72°C.
Primer of shiga toxin genes of stx1 uses forward CAGTTAATGTGGTGGCGAAGG and reverse CACCAGACAATGTAACCGCTG of 1221 bp and Stx2 forward ATCCTATTCCCGGGAGTTACG-3 and reverse GCGTCATCGTATACACAGGAGC of 1247 bp [21 (link)]. The PCR products were analyzed using 2% agarose gel electrophoresis with ethidium bromide staining, with a 100 bp DNA Ladder Marker (Promega corporation). Electrophoresis was carried out at 100 volts for 35 minutes. Visualization of the band that appeared was done through a UV transilluminator and photographed [22 ] by Spectrolyne TC-312E/F, Japan.
Primer of shiga toxin genes of stx1 uses forward CAGTTAATGTGGTGGCGAAGG and reverse CACCAGACAATGTAACCGCTG of 1221 bp and Stx2 forward ATCCTATTCCCGGGAGTTACG-3 and reverse GCGTCATCGTATACACAGGAGC of 1247 bp [21 (link)]. The PCR products were analyzed using 2% agarose gel electrophoresis with ethidium bromide staining, with a 100 bp DNA Ladder Marker (Promega corporation). Electrophoresis was carried out at 100 volts for 35 minutes. Visualization of the band that appeared was done through a UV transilluminator and photographed [22 ] by Spectrolyne TC-312E/F, Japan.
5
Genetic Diversity Analysis of cox1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products were purified with the Wizard SV Clean-up System (Promega). The final DNA concentration was estimated by comparison with a DNA Ladder Marker (Promega) in 2 % agarosegel. All amplicons were directly sequenced by targeting cox1 gene in both directions using the mentioned primers by ABIPRISMTM 3130 Genetic Analyzer automated sequencer (Applied Biosystem, USA). Ambiguous (heterozygous) sites were coded using the standard IUPAC codes for combinations of two or more bases. Contigs from all samples were aligned, justified and edited in consensus positions compared to GenBank sequences of all regional species using Sequencher Tmv.4.1.4 Software for PC (Gene Codes Corporation). The diversity testes of analyzed sequences (Haplotype diversity; Hd and Nucleotide diversity: Pi) were determined by DnaSP 5.10.1 software [49 (link)].
6
TP53 Codon 72 Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from the patient's exfoliative cytology was extracted according to the amended protocol described in Zarate et al. 14 Genomic DNA (150 ng) was amplified by polymerase chain reaction (PCR) using primers that detect TP53 codon 72 (rs1042522) in Pro72 variant (5′-GCCAGAGGC TGCTCCCCC-3′; 5′-CGTGCAAGTCACAGACTT-3) and Arg72 variant (5′-TCCCCCTTGCCGTCCCAA-3′; 5′-CTG GTGCAGGGGCCACGC-3′). 17 The PCR was obtained in a 50-µL final volume. PCR amplification was carried out on Bio-Rad's iCycler thermal cycler using the following protocol: 5 min at 95°C, 30 s at 95°C, 30 s at 60°C for Pro72 variant and 58°C for Arg72 variant, and 45 s at 72°C for 35 cycles, with an additional 5 min at 72°C after the last cycle. The PCR products were separated on a 2% TBE (Tris/borate/EDTA (ethylenediaminetetraacetic acid)) agarose gel and stained with ethidium bromide. A DNA ladder marker (Promega, USA) was used to determine the size of DNA fragment.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!