Lvcas9bst

Manufactured by Merck Group

LVCAS9BST is a laboratory equipment product offered by Merck Group. It is a tool used for gene editing applications. The core function of LVCAS9BST is to facilitate the delivery of CRISPR-Cas9 gene editing components into target cells.

Automatically generated - may contain errors

Lab products found in correlation

Lentiviral particles, by Merck Group (2 mentions) Puromycin resistance, by Thermo Fisher Scientific (2 mentions) Blasticidin antibiotic, by Thermo Fisher Scientific (2 mentions) Facsaria 2, by BD (2 mentions)

2 protocols using lvcas9bst

Generating Monoclonal CRISPR Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ready-to-use lentiviral particles were purchased from Sigma-Aldrich. hCMEC/D3 cells were transduced first by lentiviral particles expressing Cas9 and blue fluorescent protein (BFP) as a transduction marker (LVCAS9BST, Sigma-Aldrich). Cas9-expressing cells were then selected with blasticidin antibiotic at 50 μg/mL for 6 days (Life technologies). Cas9-expressing hCMEC/D3 cells were each transduced separately by lentiviral particles expressing sgRNAs and selected by puromycin resistance at 10 μg/mL for 6 days (Life technologies). sgRNA sequences are listed in Table 2.Table 2

List of sgRNAs

sgRNA name	Gene ID	Sanger Clone ID	PAM sequence	DNA target sequence
TFRC sgRNA	TFRC	HS5000003796	CGG	TGATCATAGTTGATAAGAACGG
CAV1 sgRNA	CAV1	HS0000173752	CGG	GACGTAGATGGAATAGACA
CLTC sgRNA	CLTC	HS5000032727	TGG	TAACTACAGGAAGTCGACTTGG

To generate monoclonal KO cell populations, Cas9-gRNA-expressing hCMEC/D3 were sorted (FACSAria II, BD Biosciences) using BFP into single clones and subsequently expanded.

Simonneau C., Duschmalé M., Gavrilov A., Brandenberg N., Hoehnel S., Ceroni C., Lassalle E., Kassianidou E., Knoetgen H., Niewoehner J, & Villaseñor R. (2021). Investigating receptor-mediated antibody transcytosis using blood–brain barrier organoid arrays. Fluids and Barriers of the CNS, 18, 43.

+ Open protocol

+ Expand

Generating monoclonal KO cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ready-to-use lentiviral particles were purchased from Sigma-Aldrich. hCMEC/D3 cells were transduced first by lentiviral particles expressing Cas9 and blue fluorescent protein (BFP) as a transduction marker (LVCAS9BST, Sigma-Aldrich). Cas9-expressing cells were then selected with blasticidin antibiotic at 50 g/mL for 6 days (Life technologies). Cas9-expressing hCMEC/D3 cells were each transduced separately by lentiviral particles expressing sgRNAs and selected by puromycin resistance at 10 g/mL for 6 days (Life technologies). sgRNA sequences are listed in Table 2. To generate monoclonal KO cell populations, Cas9-gRNA-expressing hCMEC/D3 were sorted (FACSAria II, BD Biosciences) using BFP into single clones and subsequently expanded.

Simonneau C., Duschmalé M., Gavrilov A., Brandenberg N., Hoehnel S., Ceroni C., Lassalle E., Knoetgen H., Niewoehner J., & Villaseñor R. (2021). Investigating receptor-mediated antibody transcytosis using Blood-Brain Barrier organoid arrays.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!