Amaxa nucleofector 2 eletroporator

For genome targeting using Crispr–Cas9 appraoches, gRNAs were designed using the online software GPP sgRNA Designer (Broad Institute) and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 vector. Exon1-gRNA (CCATCTGGCTGTACCAGTTC) and Exon 2-gRNA (CCATCACTCGCGCCTACTAC) were chosen for the generation of RAB39b KO hPSCs. PX459 V2.0 was a gift from Dr. Feng Zhang's laboratory (Addgene plasmid #62988). RAB39b KO hPSCs were generated using a previously published method (Ran et al. 2013 (link)). Briefly, hPSCs were treated with ROCK inhibitor Y27632 (10 µM; Selleckchem) for 24 h prior to electroporation. The cells were dissociated into single cells using Accutase. Three micrograms of plasmids was electroporated into 8.0 × 10⁵ cells using Amaxa Nucleofector II eletroporator (Lonza) with human stem cell nucleofector kit 1 (Lonza), then immediately plated on Geltrax-coated plates and cultured in mTeSR medium containing Y27632 (50 µM) for the first 24 h. Puromycin (0.5 µg/mL) was added to the medium for 2-d selection. Subsequently, hPSCs were maintained in medium without puromycin until colonies emerged. Individual colonies were picked up and expanded. PCR products were amplified and subjected to Sanger sequencing to identify mutant clones. The primers were Rab39b-Forward (GTCTACGCGGGGGATTACAG) and Rab39b-Reverse (TGTTATTGACCGGCCTTCCC).