Mice were decapitated and their brains were removed immediately. Coronal brain slices (1 mm) were cut using a mouse brain matrix/slicer (Braintree Sci., Inc., MA). The VTA area from each slice was then punched out using a well-polished tissue punch needle. VTA punches were homogenized and total RNA was extracted with a total RNA rapid extraction kit. HiScript II QRT SuperMix (Vazyme) was used to generate cDNA according to the following procedure: 300 ng of total RNA and 4 × gDNA wiper mix were incubated at 42 °C for 2 min to remove genome contamination, then 5 × HiScript II QRT SuperMix was added to the reaction mixture and incubated at 25 °C for 10 min, 50 °C for 30 min, and 85 °C for 5 min. The resulting cDNA was used for real-time PCR detection using a StepOnePlus real-time PCR system (Applied Biosystems, Waltham, MA, USA). The primer sequences used to amplify each product were as follows: AdipoR1 exon 2: forward-5′-CCCGTATCCACCAGACACCGG-3′; reverse-5′-GGCAATGGGGCTCCTTCTGG-3′ [31 (link)], mouse β-actin: forward-5′-GATCATTGCTCCTCCTGAGC-3′, reverse-5′-ACTCCTGCTTGCTGATCCAC-3′ [33 (link)]. The ΔΔCT method was used to obtain relative fold-change of target gene expression normalized by the housekeeping gene β-actin compared with control samples.
Hiscript 2 q rt supermix
Manufactured by Vazyme
Sourced in China, United States
The HiScript II Q RT SuperMix is a reagent designed for reverse transcription (RT) and real-time quantitative PCR (qPCR) analysis. It facilitates the conversion of RNA into cDNA and the subsequent amplification and quantification of target gene sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (128 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (71 mentions)
Chamq sybr qpcr master mix, by Vazyme (51 mentions)
Aceq qpcr sybr green master mix, by Vazyme (42 mentions)
Trizol, by Thermo Fisher Scientific (37 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (24 mentions)
Rnaiso plus, by Takara Bio (20 mentions)
Trizol reagent, by Takara Bio (17 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (16 mentions)
Aceq universal sybr qpcr master mix, by Vazyme (10 mentions)
Sybr green master mix, by Vazyme (10 mentions)
Cfx96 real time system, by Bio-Rad (10 mentions)
Ultrapure rna kit, by CWBIO (10 mentions)
Lightcycler 480 2, by Roche (9 mentions)
Chamqtm universal sybr qpcr master mix, by Vazyme (9 mentions)
Chamq sybr color qpcr master mix, by Vazyme (9 mentions)
Sybr qpcr master mix, by Vazyme (9 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (8 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (8 mentions)
Total rna extraction reagent, by Vazyme (8 mentions)
523 protocols using hiscript 2 q rt supermix
1
VTA Gene Expression Profiling in Mice
2
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA was extracted from samples using TRIzol, and Vazyme HiScript II Q RT SuperMix (Vazyme, China) was used for reverse transcription. The RT-PCR reactions were carried out as follows: 5 min at 37°C, 5 sec at 85°C, and final reduction to 4°C. qPCR was carried out using SYBR Premix Ex Taq II (Vazyme, China). The primers used (Sangon Biotech, China) are listed in Table 2 . The GAPDH was utilized as an internal reference to calculate the relative mRNA expression of target genes by the 2−(ΔΔCt) method.
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following trizol's instructions, total RNA was extracted, and Vazyme HiScript II Q RTSuper mix (Vazyme, China) was used for reverse transcription. The qPCR was conducted using the AceQ qPCR SYBR Green Master Mix (Vazyme, China). In addition, for miRNAs, miDETECT A Track™ miRNA RT-qPCR Starter Kit (RiboBio, China) was employed for performing reverse transcription and qPCR. GAPDH and U6 are employed as internal parameters for mRNAs and miRNAs, respectively. Key resources table contains a list of the primers that were utilized. By using the 2−(ΔΔCt) approach, the relative expression of each gene was computed.
4
Cytokine and Prmt Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of BMDMs was extracted using TRIzol reagent (Thermofisher) and performed reverse transcription with 5x HiScript II Q RT SuperMix (Vazyme). Real-time qPCR amplification of reverse transcription products was performed using 2x AceQ Universal SYBR qPCR Master Mix (Vazyme). The primers of each cytokine and gene are displayed in Table 1 .
Primers for qPCR
| Gene | Forward Primer (5’-3’) | Reverse Primer (5’-3’) | |
|---|---|---|---|
| Tnf-α | CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG | |
| Il-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT | |
| Nos2 | GTTCTCAGCCCAACAATACAAGA | GTGGACGGGTCGATGTCAC | |
| Il10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG | |
| Arg1 | CTCCAAGCCAAAGTCCTTAGAG | AGGAGCTGTCATTAGGGACATC | |
| Prmt1 | CTTGGCTAATGGGATGAGCCT | GCGTTGGGCTTCTCACTACTT | |
| Prmt2 | GGAAGACCCCGTGGACTATG | CCGTGGTTTGTCTCAGGATAAGA | |
| Prmt3 | CAGAGCACCAAAACACACTGG | TCAGGGTCACAATGAGGGAAC | |
| prmt4 | TGACATCAGTATTGTGGCACAG | CTGAGGAGCCTAAGGGAATCA | |
| Prmt5 | CTGAATTGCGTCCCCGAAATA | AGGTTCCTGAATGAACTCCCT | |
| Prmt6 | ATGTCGCTGAGCAAGAAAAGA | CGGAGTAGCACTCGTAGTACAG | |
| Prmt7 | GCCAGGTCATCCTATGCCG | GCCAATGTCAAGAACCAAGGC | |
| Prmt8 | ACGTGGTAGCAATCGAAGACA | GCTCCTTCATGGCAACATCC | |
| Prmt9 | CCTGAAAGAGTGTCCCTAGTTGT | TGCAGAAGTAAATGTTCCCATGC | |
5
Characterization of Macrophage Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DMEM was purchased from BasalMedia. Penicillin/streptomycin and FBS were acquired from Gibco. TRIzol reagent was obtained from Thermofisher. 5x HiScript II Q RT SuperMix and 2x AceQ Universal SYBR qPCR Master Mix were purchased from Vazyme. Recombinant murine M-CSF, IFN-γ, and IL-4 protein were purchased from Peprotech. The antibodies are listed as follows: p-STAT1 (Abclonal), STAT1 (Abclonal), p-STAT3 (Abclonal), STAT3 (Cell Signaling Technology, CST), p-STAT6 (Abcam), STAT6 (Abclonal), p-ERK (CST), ERK (CST), p-JNK (CST), JNK (CST), p-P65 (CST), P65 (CST), p-P38 (CST), P38 (Abclonal), iNOS (CST), Arg1 (CST), PRMT2 (Novus), β-actin (CST), PE anti-mouse F4/80 (Biolegend), FITC anti-mouse CD86 (Biolegend), APC anti-mouse CD206 (Biolegend).
6
RNA Extraction and RT-qPCR from Myocardial Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol (Sigma-Aldrich, St. Louis, MO, USA) method was used to extract total RNA from myocardial tissue and H9c2 cells. Then, we used a spectrophotometer to detect RNA concentration and A260/A280. Samples with A260/A280 around 2.0 can be used for subsequent experiments. We took 0.5 μg total RNA (5 μL) for reverse transcription. The 10 μL reverse transcription system is 5 + 3 μL RNase-free H2O+2 μL 5x HiScript II Q RT SuperMix (Vazyme, Nanjing, Jiangsu, China). The PCR instrument was set to 50°C for 15 min, 85°C for 5 s, and 4°C for 30 min. SYBR Green Master Mix (Vazyme, Nanjing, Jiangsu, China) was used for real-time RT-PCR. The reaction system is 5 μL SYBR Green Master Mix +0.4 μL Primer forward/reverse +1 μL cDNA template +3.6 μL ddH2O. Reaction temperature and time refer to primer company's instructions. The endogenous GAPDH expression was used as a reference. The relative expression of RNA is expressed as 2−ΔΔCt. The primer sequences are shown in Table 1 .
7
Osteogenic Differentiation Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen) was used to extract RNA. Total RNA was then converted to cDNA via HiScript Ⅱ Q RT SuperMix (Vazyme, China). PCR was conducted on a Roche LoghtCycler 96 machine (Roche) with Taq Pro Universal SYBR qPCR Master Mix (Vazyme, China). The reaction conditions were 30 s at 95°C, 40 cycles of 95°C for 10 s and 60°C for 30 s. The sequences of primers for ALP, RUNX2, OCN, and COL1 are shown in Supplementary Table S1 (Supporting Information). The value was calculated via the 2−ΔΔCt method and normalized to GAPDH.
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the jejunum and liver samples was isolated and purified using the FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme Biotech. Co., Ltd., Nanjing, China) under the corresponding instructions. The concentration of isolated RNA was measured with a NanoDrop-2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). RNA purity was estimated by detecting the absorbance ratio at 260:280 nm. RNA integrity was verified via detection of the 18S and 28S bands in 1% agarose gel electrophoresis. Thereafter, RNA samples were reverse transcribed to cDNA samples by using the HiScript Ⅱ qRT SuperMix (Vazyme Biotech. Co., Ltd., Nanjing, China). Real-time PCR for examining gene expression was implemented in a CFX96Touch Real-Time PCR system (Bio-Rad Laboratories, Hercules, CA, USA) using the 2×Taq Master Mix (Vazyme Biotech. Co., Ltd., Nanjing, China). Reduced glyceraldehyde-phosphate dehydrogenase (GAPDH) acted as a reference gene. Information for the primers of GAPDH and target genes, including nuclear factor erythroid-2 related factor (Nrf2), heme oxygenase 1 (HO-1), B-cell lymphoma-2 (Bcl-2), Bcl-2 associated X protein (Bax), and caspase-9, are displayed in Table 4 . The relative mRNA expressions of genes were calculated using the 2−ΔΔCt method [55 (link)].
9
Quantification of miR-491-5p and MMP-9 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from VSMCs, tissue lysates, or plasma samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The concentrations of RNA were detected by a NanoDrop ND-1000 instrument (Thermo Fisher, MA, USA). For reverse transcription, the total RNA was reverse-transcribed into first-strand cDNA using the HiScript™ Ⅱ Q RT SuperMix (Vazyme). Then, the qRT-PCR analysis was performed with a Step one plus system (Roche Molecular Diagnostics, Pleasanton, CA, USA) using ChamQ™ Universal SYBR qPCR Master Mix (Vazyme). The reaction conditions were as follows: 35 cycles of denaturation at 95°C for 60 s, annealing at 60°C for 60 s, and chain extension at 72°C for 1 min, followed by a final extension step at 72°C for 10 min. The relative expression levels of miR-491-5p were normalized to U6, and the relative expression levels of MMP-9 were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences for PCR are listed as follows:
miR-491-5p forward: 5′-GGAGTGGGGAACCCTTCC-3′;
reverse: 5′-GTGCAGGGTCCGAGGT-3′;
U6 forward: 5′-GCTTCGGCAGCACATATACTAAAAT-3′;
reverse: 5′-CGCTTCACGAATTTGCGTGTCAT-3′;
MMP-9 forward: 5′-AGACCTGGGCAGATTCCAAAC3′;
MMP-9 reverse: 5′-CGGCAAGTCTTCCGAGTAGT-3′;
GAPDH forward: 5′-CTTTGGTATCGTGGAAGGACTC-3′;
reverse: 5′-GTAGAGGCAGGGATGATGTTCT-3′. The relative expression levels were quantified using the 2−ΔΔCq method [20 (link)].
10
Quantifying TXNIP Expression in PFC Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of PFC tissues or primary astrocytes was extracted by Trizol (15596018, Invitrogen). Isolated RNA was dissolved in diethyl pyrocarbonate (DEPC) H2O. HiScriptⅡqRT Supermix (Vazyme) was used to reverse RNA to cDNA. Expression of TXNIP was quantified using qRT-PCR. The primers used in this study were listed as follows: TXNIP, sense, TTTCTGCCTCTCTGCTTG and antisense, GACTTGCCTACTGATTGCC; β-Tubulin, sense, CATCACAGGCAAGGAAGA and antisense, GTGGAAAACCAAGAAGCC. SYBR® Green was combined with DNA during amplification (Bio-Rad CFX96). Relative expression of TXNIP was analyzed by 2−△△Ct method with β-Tubulin as internal control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!