Maxwell 16 cell dna purification kit

The presence of junctions between the AAVS1 genomic locus and the 3′ and 5′ of the donor DNA construct was tested in gDNA extracted using Maxwell 16 Cell DNA Purification Kit (Promega) following manufacturer's instructions. For the LV‐GFP targeting in the AAVS1 site, we set a PCR (AmpliTaq Gold DNA polymerase system by Applied Biosystems) using primers for detecting the 5′ junction (AAVS1 fw: 5′‐AACTCTGCCCTCTAACGCTGC‐3′; ΔNef rv: 5′‐CGAGCTCGGTACCTTTAAGACC‐3′) and for detecting the 3′ junction (Gag fw: 5′‐GAGTCCTGCGTCGAGAGAG‐3′; AAVS1 rv: 5′‐AACGGGGATGCAGGGGAACG‐3′). For LV‐FIX or LV‐FIX‐Padua targeting in the AAVS1 site, we set a PCR using primers for detecting the 5′ junction (AAVS1 fw: 5′‐AACTCTGCCCTCTAACGCTGC‐3′; GFP rv: 5′‐GTCTTGTAGTTGCCGTCGTCC‐3′) and for detecting the 3′ junction (Gag fw: 5′‐GAGTCCTGCGTCGAGAGAG‐3′; AAVS1 rv: 5′‐AACGGGGATGCAGGGGAACG‐3′). PCR products were analyzed on a 1% agarose gel.

All confirmed ESBL bacteria using the combined disk method were analyzed by Real time PCR for the presence of genes encoding TEM, SHV, CTX-M. Primers and Probes were designed for ESBL producing genes by LGC, Biosearch, USA based on primers used by Roschanski et al., 2014 [25 (link)].
Genomic DNA was extracted using Maxwell 16 cell DNA purification kit (Promega) on an automated DNA extraction machine (Maxwell 16 extraction system, USA). Real time PCR assay was performed on AriaMx system (Agilent Inc, USA) using 25 μL PCR reaction mixture containing 12.5 μL Perfecta master mix low ROX kit (Quanta Bioscience Inc, USA), 1 μL of 10 μM primers, 1 μL of probes, 7.5 μL Nuclease free water (Sigma-Aldrich, USA) and 2 μL DNA template. The thermal conditions were as follows: denaturation at 95°C for 15 min, then 30 cycles consisting of a denaturation step at 95°C for 15 seconds, annealing at 50°C for 15 seconds and extension at 70°C for 20 seconds.
After completion of the run, a cycle threshold (Ct) was calculated by determining the signal strength at which the fluorescence exceeded a threshold limit. This value was analyzed using the AriaMx system software version 3.1.

Genomic DNA was extracted from E. coli isolates using the Maxwell 16-cell DNA purification kit (Promega, Madison, WI, USA). STs of each strain were determined using multilocus sequence typing (MLST), with the Achtman scheme (24 (link)), by allele numbering the seven housekeeping genes, namely, adk, fumC, gyrB, icd, mdh, purA, and recA. A minimum spanning tree was constructed using PHYLOViZ 2.0 (25 (link)) with the allelic profile of each ST. Subgroups of the ST131 isolates were identified by (i) fimH typing, using the database for the single nucleotide polymorphism (SNP)-based numbering system (26 (link)), (ii) ciprofloxacin resistance, and (iii) SNP-based x typing (27 (link)). For resistance genotyping, the ESBL bla_CTX-M gene and the plasmid-mediated ampC gene primer pairs were used (21 (link)). To genotype the virulence, eight pairs of primers each for adhesin genes, i.e., afaA, papC, papG, and focG, and for toxin genes, i.e., cnf1, hlyF, sat, and cdtB (2 (link)), were designed and used to screen for the presence of the gene.

Fourteen clinical P. aeruginosa strains including five bla_GES segments (GES-1, -5, -7, -9, and -19/20-like) were randomly selected from 388 strains with previously reported genotypes and phenotypes (Kos et al., 2015 (link); Table 2) isolated from diverse geographical locations (Colombia, India, Spain, France, Greece, Germany, Argentina, Croatia, China, Brazil, Mexico, and the Philippines) between 2003 and 2012. Genomic DNA was extracted using the Maxwell 16-cell DNA purification kit (Promega). Whole-genome sequences were analyzed using the HiSeq 2000 or MiSeq platforms (Illumina, San Diego, CA, United States). Susceptibility to meropenem was explored using frozen Trek-Sensititre custom plates (Thermo Fisher Scientific Inc.) following the guidelines of the Clinical and Laboratory Standards Institute (2012) . The results of meropenem MIC are listed in Table 2. We used genomic DNA from P. aeruginosa strain AZPAE4948 to evaluate the LAMP assay.

Total DNA was extracted with the Wizard Genomic DNA Kit (Promega, Madison, WI, USA), the Maxwell 16-cell DNA purification kit (Promega) or the MagNA Pure DNA isolation kit (Roche Molecular Systems, Indianapolis, IN, USA), in accordance with the manufacturer’s recommendations. The 4187 strains and isolates were sequenced with different Illumina platforms. FqCleanER version 3.0 (https://gitlab.pasteur.fr/GIPhy/fqCleanER) was used to eliminate adaptor sequences^{37 (link)}, correct sequencing errors^{38 (link)} and discard low-quality reads. Assemblies were generated with SPAdes^{39 (link)} version 3.15.

Total DNA was extracted with the Wizard Genomic DNA Kit (Promega, Madison, WI, USA), the Maxwell 16-cell DNA purification kit (Promega, Madison WI) or the DNeasy Blood & Tissue Kit (Qiagen), in accordance with the manufacturer’s recommendations.