VEEV TC83 was diluted to 1 × 106 PFU/mL in whole human blood or plasma followed by incubation with or without NT particles at the indicated humidity and temperature conditions for various time points. Viral RNA was purified using a combination of a TriZol® LS from Ambion and RNeasy mini kit (Qiagen). Briefly, whole human blood containing viral virions was mixed in 1:3 ratio with TriZol LS. Hundred microliter of PBS were added to the sample in order to increase the amount of the aqueous fraction. Samples were vortexed and 200 μL of chloroform were added to the blood TriZol LS mixture. After intensive vortexing and spinning down the upper aqueous fraction containing nucleic acids was collected and used for RNA purification by RNeasy kit (Qiagen) according to the manufacturer's protocol. Purified RNA was used for cDNA synthesis followed by PCR reaction (30 cycles) using a One Step RT-PCR kit (ThermoFisher Scientific). For this purpose, the following set of primers was used: 5′-CTG CTC GCC AAT GTG ACG TTC-3′; 5′-AGC CTG CTC TGT TGA CTA TAG TGT TAT ACG-3′. To visualize the quantity of viral cDNA 10 μl of the PCR product were loaded on 1% agarose gel supplemented with ethidium bromide, followed by gel electrophoresis. Samples were visualized on a ChemiDoc instrument from Bio-Rad and densitometrically analyzed using Image Lab Software from Bio-Rad.
One step rt pcr kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The One-Step RT-PCR kit is a laboratory instrument designed for reverse transcription and polymerase chain reaction (RT-PCR) analysis. It enables the conversion of RNA into complementary DNA (cDNA) and subsequent amplification of target genetic sequences in a single reaction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Abi vii7 system, by Thermo Fisher Scientific (6 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (4 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (3 mentions)
Thermo start taq, by Thermo Fisher Scientific (3 mentions)
Quick rna miniprep kit, by Zymo Research (3 mentions)
Rnaiso kit, by Takara Bio (3 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Superscript 3 platinum one step qrt pcr kit, by Thermo Fisher Scientific (2 mentions)
Qiaamp viral rna mini kit, by Qiagen (2 mentions)
Cfx96 touch quantitative pcr system, by Bio-Rad (2 mentions)
Sybr primerscript rt pcr kit, by Takara Bio (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Rnase free dnase set, by Qiagen (2 mentions)
Qiaamp minelute kit, by Qiagen (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Total rna extraction kit, by Thermo Fisher Scientific (2 mentions)
Dulbecco s modified eagle s medium dmem, by Corning (2 mentions)
84 protocols using one step rt pcr kit
1
VEEV TC83 RNA Quantification Protocol
2
One-Step RT-PCR for RNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from swabs by means of the QIAamp Viral RNA Mini kit (Qiagen, Hilden, Germany).
One-step real time RT-PCR was performed in a final volume of 25 μl with 0.8 μM forward and reverse primers, 0.2 μM probe and 5 μl of extracted RNA, in accordance with the manufacturer’s instructions for the use of the One-Step RT-PCR Kit (SuperScript III Platinum One-Step qRT-PCR Kit, Thermo Fisher Scientific, Waltham, MA, USA): Cycling conditions were 50°C for 30 minutes, 95°C for 2 minutes and 45 cycles of 15 seconds at 95°C and 30 seconds at 55°C. Fluorescence was measured during the 55°C annealing/extension step.
One-step real time RT-PCR was performed in a final volume of 25 μl with 0.8 μM forward and reverse primers, 0.2 μM probe and 5 μl of extracted RNA, in accordance with the manufacturer’s instructions for the use of the One-Step RT-PCR Kit (SuperScript III Platinum One-Step qRT-PCR Kit, Thermo Fisher Scientific, Waltham, MA, USA): Cycling conditions were 50°C for 30 minutes, 95°C for 2 minutes and 45 cycles of 15 seconds at 95°C and 30 seconds at 55°C. Fluorescence was measured during the 55°C annealing/extension step.
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was cleaved using TRIzol reagent and used to synthesize cDNA using a one-step RT-PCR kit (Thermo Fisher Scientific, CA). An ABI Vii7 system (Applied Biosystems, USA) was used for real-time PCR. Glyceraldehyde-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene. The relative gene expression level was calculated by the comparative CT method (ΔΔCT). The primers used in the study are listed in Table 1 .
4
Quantification of Avian Reovirus in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Virus gene copy numbers in intestine and tendon samples were estimated using a universal avian reovirus rRT-PCR available at the Veterinary Diagnostic Laboratory, University of Minnesota (https://www.vdl.umn.edu/node/15341 , 20 December 2021) using AgPath-ID™ (Thermo Fisher Scientific, Waltham, MA, USA). The One-Step RT-PCR kit (ThermoFisher, Waltham, MA, USA) was used following the manufacturer’s instructions. Briefly, 25 µL of reaction mix contained 12.5 µL of AgPath master mix, 1 µL of enzyme mix, 1 µL (10 µm/µL) of each primer, 1 µL (5 µm/µL) of each probe, 5 µL each of viral RNA, and nuclease free water. The reaction conditions were 45 °C for 10 min, 95 °C for 10 min, and 40 cycles of 95 °C for 15 sec and 60 °C for 45 s. A standard curve was plotted using 10-fold serial dilutions of TARV-positive RNA included with each 96-well plate. The gene copy numbers were calculated in intestine and tendon samples collected at different time points and the data was subjected to appropriate statistical analysis.
5
Quantitative Real-Time PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was lysed using TRIzol reagent and used for the synthesis of cDNA with a One-Step RT-PCR Kit (Thermo Fisher Scientific). Reactions of qRT-PCR were performed using the ABI Vii7 system (Applied Biosystems, USA). GAPDH was used as a housekeeping gene. Relative gene expression was calculated by the 2-△△CT cycle threshold method [33 (link)]. The primers used for qRT-PCR analysis are listed in Table 2 .
Oligonucleotide primer sequences for qRT-PCR.
| Gene | Forward primer (5’-3’) | Reverse primer (5’-3’) |
|---|---|---|
| METTL3 | CAAGCTGCACTTCAGACGAA | GCTTGGCGTGTGGTCTTT |
| METTL14 | CTGGGGAGGGGTTGGACCTT | CCCCGTCTGTGCTACGCTTC |
| RBM15 | TCCCACCTTGTGAGTTCTCC | GTCAGCGCCAAGTTTTCTCT |
| WTAP | CTTCCCAAGAAGGTTCGATTGA | TCAGACTCTCTTAGGCCAGTTAC |
| VIRMA | AATCCTGTGGGAAGATCAGC | ACACGTAAGGCAGTGGTAAG |
| FTO | CCAGAACCTGAGGAGAGAATGG | CGATGTCTGTGAGGTCAAACGG |
| ALKBH5 | CCAGCTATGCTTCAGATCGCCT | GGTTCTCTTCCTTGTCCATCTCC |
| HOXA10 | AGATTAGCCGCAGCGTCCAC | GTAACGGCCCAGGAGATGGC |
| ITGB3 | TGTGTCCGCTACAAGGGGGA | TGTAGGGCTCCCCGGTCAAA |
| EMX2 | CGGTAGGGGCGTCTACTCCA | TCGGATCCGCTTGGGCTTTC |
| GAPDH | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA |
6
Apoptosis Pathway Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First, 1.25 × 105 Hep3B cells were plated and treated with 1 at 21.31 µM for 72 h, then total RNA was isolated employing a Quick-RNA MiniPrep Kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions. RNA was quantified using NanoDrop ND-1000 (Thermo Scientific, Waltham, MA, USA) and the RNA content was normalized. The RT-PCR was performed using a One-Step RT-PCR Kit with Thermo-Start Taq (Thermo Scientific, Waltham, MA, USA) following the manufacturer’s instructions. PCR was performed with the following primers sequences: Bcl-2 (F 5′-TAC AGG CTG GCT CAG GAC TAT-3′; R 5′-CGC AAC ATT TTG TAG CAC TCT G-3′), Bax (F 5′-CCC GAG AGG TCT TTT TCC GAG-3′; R 5′-CCA GCC CAT GAT GGT TCT GAT-3′), GAPDH (F 5′-CAA GGT CAT CCA TGA CAA CTT TG-3′; R 5′-GTC CAC CAC CCT GTT GCT GTA G-3′). Sequencing was performed at the Instituto de Biotecnología of Universidad Nacional Autónoma de México. The reaction products of the samples were analyzed in 1.5% agarose gel.
7
Quantitative Analysis of HIF-1α, IGF-1R, and VEGF Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using TRIzol® Reagent. Quantitative PCR analysis of HIF-1α, IGF-1R and VEGF mRNA levels was performed using the One-step RT-PCR kit from Thermo Fisher Scientific, according to the manufacturer’s instructions. The following primers were designed for quantitative PCR: HIF-1α forward, 5′-ACTAAAGGACAAGTCACCACAGGA-3′ and reverse, 5′-TGCTGAATAATACCACTCACAACG-3′; IGF-1R forward, 5′-CTCAGTTAATCGTGAAGTGGAACC-3′ and reverse 5′-GCAGTAATTGTGCCGGTAAAGG-3′; VEGF forward, 5′-GAGGGCAGAATCATCACGAAGT-3′ and reverse, 5′-TCCTATGTGCTGGCCTTGGTGA-3′; and β-actin forward, 5′-CACACAGGAGAGGTGATAGCAAGT-3′ and reverse, 5′-GACCAAAAGCCTTCATACATCTCA-3′. All primers were synthesized by Shanghai Sangon Biological Engineering Technology and Services Co., Ltd. (Shanghai, China). The thermocycling conditions were as follows: 95°C for 5 min; 72°C for 10 min; and 40 cycles at 95°C for 10 sec and 50°C for 30 sec for HIF-1α and IGF-1R, or 60°C for 30 sec for VEGF. The relative HIF-1α, IGF-1R and VEGF mRNA levels were normalized to β-actin. The experiment was repeated in triplicate.
8
Quantifying P-gp mRNA in Hep3B Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the analysis of P-gp mRNA levels in Hep3B and Hep3B/PTX cells, 2 × 105 cells were seeded and treated with Achillin 100 µM, PTX 25 nM, and combination of Achillin 100 µM + PTX 25 nM. Then RNA was isolated. The total RNA extraction was performed employing a Quick-RNA MiniPrep Kit (Zymo Research, Irvine, CA, USA), following the manufacturer’s instructions. RNA was quantified using NanoDrop® ND-1000 (Thermo Scientific, Waltham, MA, USA), and the RNA content of the samples was normalized. The RT-PCR was performed using a One-Step RT-PCR Kit with Thermo-Start Taq (Thermo Scientific, Waltham, MA, USA) following the manufacturer’s instructions. The primer sequences for Bcl-2 were 5-CCC TCC AGA TAG CTC ATT-3 and 5-CTAGACAGACAAGGAAAG-3. The Bax primer sequences were 5-ATGGACGGGTCCGGGGAG-3 and 5-TCAGAAAACATGTCAGCTGCC-3. The P-gp primers were 5-ACCATGGATCTTGAAGGGGACC-3 and 5-CCTCCAGATTCATGAAGAACCC-3. The GAPDH primers were 5-CAAGGTCATCCATGACAACTTTG-3 and 5-GTCCACCACCCTGTTGCTGTAG-3. All primers were synthesized by IDT-Integrated DNA Technologies (Redwood, CA, USA), and the reaction products of the samples were analyzed in 1.5% agarose gel.
9
RT-PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was performed by one-step RT-PCR kit from Thermo Fisher Scientific (Waltham, MA, USA), which enables retrotranscription and cDNA amplification to occur in a single step. β-actin was used as a housekeeping gene and the primers were added to the target gene primers in the same tube. The primer sequences are reported in Table S1 . PCR products were loaded onto a 2% agarose gel, run in an electrophoresis chamber, stained by ethidium bromide, and visualized with a UV transilluminator. Bands were analyzed by Kodak Electrophoresis Detection and Analysis System (EDAS 290) (Eastman Kodak Company, Rochester, NY, USA).
10
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by TRIzol reagent and used to synthesize cDNA with the One-Step RT-PCR Kit (ThermoFisher Scientific, Shanghai, China). The cDNA samples were used for qRT-PCR analysis by using the SYBR Primer-Script RT-PCR kit (Takara, Shiga, Japan) with a CFX96 Touch quantitative PCR system (Bio-Rad Laboratories, CA, USA). The amplify conditions were: denaturation at 95°C for 10 minutes, and at 95°C for another 10 seconds, for a total of 40 cycles, and in the end, at 60°C for 30 seconds. Three replicates were performed for each specimen, and GAPDH served as internal references. The ΔΔCt method was utilized for quantification. The sequence information of primers is listed in Table 1 .
The Primers Used in This Study
| Primers | Sequence (5ʹ-3ʹ) |
|---|---|
| RAMP2-AS1 Forward | GAACTCAGGCCAGATTTACAAG |
| RAMP2-AS1 Reverse | TTGGGTCCTACAGCAACCAT |
| VEGFR2 Forward | GTGATTGCCATGTTCTTCTGGC |
| VEGFR2 Reverse | TTCATCTGGATCCATGACGA |
| GAPDH Forward | CAAGGCTGAGAACGGGAAG |
| GAPDH Reverse | TGAAGACGCCAGTGGACTC |
| miR-2355-5p Forward | ATTGTCCTTGCTGTTTGGAGAT |
| miR-2355-5p Reverse | GCGAGCACAGAATTAATACGAC |
| U6 Forward | CGCTTCGGCAGCACATATAC |
| U6 Reverse | TTCACGAATTTGCGTGTCAT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!