N-α-Fmoc-protected amino acids, coupling reagents 1-Hydroxy-7-azabenzotriazole (HOAt) and 2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethyluronium hexafluoro-phosphate (HBTU), N, N-Diisopropylethylamine (DIEA), piperidine and trifluoroacetic acid (TFA) were purchased from Iris Biotech (Germany). Rink Amide-ChemMatrix resin was purchased from Biotage AB (Sweden). Peptide synthesis solvents, reagents, as well as CH3CN for High Performance Liquid Chromatography (HPLC) were reagent grade and were acquired from commercial sources and used without further purification unless otherwise noted. Ultrapure water (H2O) was obtained by a Direct-8 Milli-Q system (Millipore, Milan, Italy).
Rink amide chemmatrix resin
Manufactured by Biotage
Sourced in Sweden
Rink Amide-ChemMatrix resin is a versatile solid-phase support used in peptide synthesis. It is a polymeric resin designed to facilitate the synthesis of peptides and peptide-like compounds. The resin provides a stable and inert platform for the attachment and subsequent chemical modifications required in peptide synthesis.
Automatically generated - may contain errors
Lab products found in correlation
4 methylpiperidine, by Thermo Fisher Scientific (3 mentions)
Piperidine, by Iris Biotech (3 mentions)
Diethyl ether, by Thermo Fisher Scientific (2 mentions)
Trifluoroacetic acid, by Iris Biotech (2 mentions)
N n diisopropylethylamine, by Iris Biotech (2 mentions)
Rink amide resin, by Iris Biotech (2 mentions)
N n dimethyldodecylamine n oxide ldao, by Merck Group (2 mentions)
Fos choline 12, by Anatrace (2 mentions)
Decyl β d maltopyranoside, by Anatrace (2 mentions)
2 6 chloro 1h benzotriazole 1 yl 1 1 3 3 tetramethylaminium hexafluorophosphate hctu trifluoroacetic acid tfa, by Chem-Impex (2 mentions)
Hydroxybenzotriazole hydrate hobt, by Chem-Impex (2 mentions)
N dodecyl n n dimethyl 3 ammonio 1 propanesulfonate c12 betaine triton x100, by Merck Group (2 mentions)
Fmoc protected amino acids, by GL Biochem (2 mentions)
Syro 2 parallel peptide synthesizer, by Biotage (2 mentions)
Initiator alstra peptide synthesizer, by Biotage (2 mentions)
Milli q direct 8 system, by Merck Group (1 mentions)
Trifluoroacetic acid tfa, by Iris Biotech (1 mentions)
Standard protected amino acids, by Bachem (1 mentions)
Acetonitrile, by Thermo Fisher Scientific (1 mentions)
Methanol, by Thermo Fisher Scientific (1 mentions)
17 protocols using rink amide chemmatrix resin
1
Solid-Phase Peptide Synthesis Protocol
2
Radiolabeled Anti-HER2 Affibody Probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Targeting Probes Z HER2:342 -SR-HP1 and HP2 were produced and purified as described earlier (22, 24) . Briefly, the PNA hybridization probes, HP1 and HP2, were created using manual Fmoc-protected solid-phase synthesis on a Rink-Amide ChemMatrix resin (Biotage) with commercially available building blocks. HP1 was covalently and sitespecifically ligated to an anti-HER2 Affibody using an enzymatic, sortase A-mediated ligation. The Affibody construct, Z HER2:342 -SR-H 6 , was expressed in Escherichia coli and purified using standard protocols for His 6 -tagged proteins before ligation. The targeting agent Z HER2:342 -SR-HP1 and the secondary agent HP2 were purified on a reversed-phase high-performance liquid chromatography column using a water/acetonitrile gradient with 0.1% trifluoroacetic acid. The final purity of Z HER2:342 -SR-HP1 and HP2 was at least 95% as judged by analytic reversed-phase high-performance liquid chromatography.
For labeling, a solution of HP2 in 1 M ascorbic acid, pH 5.5 (0.5 mg/mL), was mixed with 177 Lu-chloride (4.8 MBq/mg of HP2). The mixture was incubated at 95°C for 60 min, and radiochemical purity was measured using radio-instant-thin layer chromatography eluted with 0.2 M citric acid, pH 2.0. The purity of Z HER2:342 -SR-HP1 was over 95%. The radiochemical purity of 177 Lu-HP2 was over 98%, and the specific activity was 24.7 GBq/mmol.
For labeling, a solution of HP2 in 1 M ascorbic acid, pH 5.5 (0.5 mg/mL), was mixed with 177 Lu-chloride (4.8 MBq/mg of HP2). The mixture was incubated at 95°C for 60 min, and radiochemical purity was measured using radio-instant-thin layer chromatography eluted with 0.2 M citric acid, pH 2.0. The purity of Z HER2:342 -SR-HP1 was over 95%. The radiochemical purity of 177 Lu-HP2 was over 98%, and the specific activity was 24.7 GBq/mmol.
3
Solid-Phase Peptide Synthesis Reagents
4
Solid-Phase Peptide Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nα-Fmoc-protected amino acids, Wang resin, Rink amide-resin, coupling reagents, N,N-Diisopropylethylamine (DIEA), piperidine and trifluoroacetic acid (TFA) were purchased from Iris Biotech (Germany). Rink Amide-ChemMatrix resin was purchased from Biotage AB (Sweden). Peptide synthesis solvents, reagents, as well as CH3CN for High Performance Liquid Chromatography (HPLC) were reagent grade and were acquired from commercial sources and used without further purification unless otherwise noted.
5
Solid-Phase Peptide Synthesis Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fmoc-d -Ile-OH, Fmoc-d -Thr(Trt)-OH, and oxyma pure were purchased from Merck Millipore (Watford, UK). All l -amino acids, 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU), Fmoc-d -Gln(Trt)-OH, Boc-d -Nmethylphenyl-OH, Fmoc-d -Cys-OH, Fmoc-l -Cys-OH, Fmoc-Glu(OAll)-OH, Diisoproplycarbodiimide, and Triisopropylsilane were purchased from Fluorochem, Hadfield, UK. The protecting groups for the amino acids are Pbf for Arg and Trt for Gln, unless specified otherwise. Diisopropylethylamine, supplied as extra-dry, redistilled, and 99.5% pure, was purchased from Sigma Aldrich (Gillingham, UK). Peptide-synthesis grade Dimmethylformamide (DMF) and Trifluoroacetic acid (TFA) was purchased from Rathburn chemicals (Walkerburn, UK). Diethyl ether, i-PrOH, MeOH (HPLC grade), and Acetonitrile (HPLC grade) were purchased from Fisher Scientific (Loughborough, UK). Water with the Milli-Q grade standard was obtained in-house from an ELGA Purelab Flex system. Rink amide Chemmatrix resin (manufacturer’s loading = 0.49 mmol/g) was obtained from Biotage, Uppsala, Sweden. All chemicals were used without further purification.
6
Synthesis of Galactosylated Serine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All Fmoc-protected amino acids and PyBOP were purchased from Novabiochem, HBTU was from Peptide Institute Inc. HOBT was from Kokusan Kagaku Corp. HOAt was from GenScript. Rink-amide-ChemMatrix resin was from Biotage. N-(9-Fluorenylmethoxycarbonyl)-O-[2,3-di-O-acetyl-4-O-(2,3,4,6-tetra-O-acetyl-β-D-galactopyranosyl)-β-D-xylopyranosyl]-L-Serine was purchased from Medicinal Chemistry Pharmaceutical Ltd., Japan (http://soyaku.co.jp/ ). Coating reagents, 11,11'-dithio bis[undec-11-yl 12-(aminooxyacetyl)amino hexa(ethyleneglycol)] (AOSH) and a phosphoryl derivative, 11-mercaptoundecylphosphorylcholine (PCSH) were synthesized by the procedures reported previously and available from MCP Co. Ltd. Qdot 545 ITK™, Lysotracker Red DND-99, and Hoechst 33342 were from Invitrogen. DCM, DMF, DIEA and TFA were purchased from Watanabe Chem. IND., LTD. Ultrafiltration membranes were supplied from Millipore, Carrigtwohill, Co. Cork, Ireland. Unless otherwise noted, solvents and other reagents were purchased from Aldrich Chemical Co. (Milwaukee, WI), Tokyo Chemical Industry (Tokyo, Japan), and Wako Pure Chemical Industries Ltd. (Tokyo, Japan).
7
Synthesis and Characterization of Nucleic Acid Probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides (RNA and DNA), phosphorothioate-modified guanosine 12-mer, 32-base probe RNA and FITC-labeled 32-base probe RNA were purchased from Fasmac (Kanagawa, Japan). The 32-base probe sequence was derived from NC_045512.2 (nt29733–29764: CGAGGCCACGCGGAGUACGAUCGAGUGUACAG). The guanosine 12-mer was purchased from Aji Bio-Pharma (Osaka, Japan). PNA-G6 was synthesized using Biotage Initiator+ microwave peptide synthesizer (Biotage, Uppsala, Sweden) based on Fmoc/Bhoc chemistry with a Rink-Amide-Chem Matrix resin (Biotage). The crude product was purified and verified according to the published literature (27 (link)). DNA oligonucleotides were purchased from Fasmac. Other reagents were purchased from Nacalai Tesque (Kyoto, Japan).
8
Peptide Synthesis with Fluorescent Labeling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Coupling agents (HOAt, HOBt, HBTU), Nα-Fmoc-protected amino acids, DIEA, piperidine, and trifluoroacetic acid were provided by Iris Biotech (Marktredwitz, Germany). Peptide synthesis was performed using a Rink Amide-ChemMatrix resin (Biotage AB, Uppsala, Sweden). All other solvents and reagents were of analytical grade, commercially available and were used without further purification unless otherwise noted. 5(6)-Carboxyfluorescein (FAM; mixture of isomers, 97%; MW 376.3 g/mol) and fluorescein (FL; MW 332.31 g/mol) were from Merck (Darmstadt, Germany), while bovine serum albumin (BSA) and dimethylsulfoxide (DMSO) were purchased from Sigma Aldrich (St. Louis, MO, USA). Phosphate buffered saline (PBS) was prepared by dissolving 0.19 g/L KH2PO4, 2.37 g/L Na2HPO4, 8.8 g/L NaCl in pure water (Purelab® Pulse, ELGA LabWater, High Wycombe, UK); final pH was adjusted to 7.4 with H3PO4 (85 wt. %).
9
Peptide Synthesis and Purification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All reagents were used without further treatment. Fmoc-protected amino acids were purchased from GL Biochem. 2-(6-Chloro-1H-benzotriazole-1-yl)-1,1,3,3-tetramethylaminium hexafluorophosphate (HCTU), trifluoroacetic acid (TFA), and hydroxybenzotriazole hydrate (HOBt) were purchased from Chem-Impex International. 4-methylpiperidine were purchased from Acros Organics. Rink Amide-ChemMatrix resin (0.5 mmol/g loading) was purchased from Biotage. All other reagents including tris(2-carboxyethyl)phosphine hydrochloride (TCEP), DL-Dithiothreitol (DTT), N,N-Dimethyldodecylamine N-oxide (LDAO), N-Dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate (C12 Betaine), Triton X100 were purchased from Sigma-Aldrich. Fos-choline-12 (DPC), Decyl β-D-maltopyranoside (DM) were purchased from Anatrace. Sodium dodecyl sulfate (SDS) was purchased from Calbiochem, IPTG (isopropyl β-D-1-thiogalactopyranoside) was purchased from Genesee Scientific Corporation.
10
Solid-Phase Peptide Synthesis Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!