Pcr buffer

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Canada, Lithuania

PCR buffer is a solution used in the polymerase chain reaction (PCR) process to maintain the optimal pH and ionic conditions for the enzymatic amplification of DNA. It provides a suitable environment for the DNA polymerase enzyme to function effectively.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

AccuPrime PCR Buffer II (15 citations) Phusion High-Fidelity PCR Master Mix with HF Buffer (12 citations) PCR Buffer II (12 citations) High Fidelity PCR buffer (9 citations) Phusion High-Fidelity PCR Master Mix with GC Buffer (8 citations) GeneAmp PCR buffer (7 citations) GeneAmp 10X PCR Buffer II (5 citations) AmpliTaq Gold PCR buffer (5 citations) Taq DNA Polymerase PCR buffer (4 citations) Platinum Green PCR Buffer (3 citations)

198 protocols using pcr buffer

RT-PCR for Infectious Bronchitis Virus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers and reaction conditions described by Cavanagh et al. (2002 (link)) (Table 1), were used with some modifications. An infectious bronchitis virus strain H120 was used as positive control. Next, 7 μl of each RNA were resuspended in DEPC water, denatured at 95 °C for 5 min and added to the reverse transcription mix containing 1 × First Strand Buffer, 1 mM of each of dNTP, DTT 10 mM, 1 μM of each primer (UTR 41 and UTR 11), and 200U of M-MLV reverse transcriptase (InvitrogenTM) to a final reaction of 20 μl. The reverse transcription was carried out at 45 °C/60’, followed by 72 °C/10’. The PCR was performed with the addition of 5 μl of c-DNA to a PCR mix containing 1 × PCR Buffer (Invitrogen™), 0.2 mM of each dNTP, 0.5 μM of each primer ⁽UTR 41 and UTR 11), 1.5 mM MgCl2, 28.25 μl of ultra-pure water and 2.5 U of Taq DNA polymerase (Invitrogen™) to a final reaction of 50 μl and submitted to 94 °C/3’ for initial denaturation, followed by 35 cycles of 94 °C/1’, 48 and 72 °C/1’30” and a final extension at 72 °C/10’.
The nested step was performed with the addition of 5 μl of the PCR product to the nested mix (1 × PCR Buffer (Invitrogen^TM), 0.2 mM of each dNTP, 0.5 μM of each primer (UTR 41 and UTR 31), 1.5 mM MgCl2, 28.25 μl of ultra-pure water, and 2.5U of 164 Taq DNA polymerase (Invitrogen™) to a final reaction of 50 μl and submitted to the same cycles of the PCR step.

Moura-Alvarez J., Nuñez L.F., Astolfi-Ferreira C.S., Knöbl T., Chacón J.L., Moreno A.M., Jones R.C, & Ferreira A.J. (2014). Detection of enteric pathogens in Turkey flocks affected with severe enteritis, in Brazil. Tropical Animal Health and Production, 46(6), 1051-1058.

+ Open protocol

+ Expand

Single-cell RNA Extraction and Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ten cells were collected in individual PCR tubes containing 5 µL PBS 1× following cell sorting on a FACSAria III U equipped with an automatic cell deposition unit (ACDU, BD Biosciences, San Diego, USA). Cells were lysed by freezing at −80 °C, followed by heating to 65 °C for 2 min.
After cooling at 4 °C, RNA was specifically reverse transcribed by adding 10 μL of a mix containing 0.13 μM RT primer, 1× PCR Buffer (Thermo), 3.3 mM MgCl₂ (Thermo), 1 mM dNTPs (GE Healthcare), 40 units of RNaseOUT (Thermo), and 35 units of MuLV Reverse Transcriptase (Thermo), in a 15 μL reaction volume for 1 h at 37 °C and then incubated for 3 min at 95 °C for inactivation of reverse transcriptase. cDNA generated were dilute with 30 µL of 1× PCR Buffer.
A 4 µL aliquot of diluted cDNA was then amplified: first, a denaturation step at 95 °C for 10 min and then 54 amplification cycles (30 s at 95 °C, 45 s at 70 °C, and 60 s at 72 °C, with the hybridization temperature decreased from 70 to 60 °C during the six first cycles). The PCR mix contained 0.25 μM of each primer (Reverse and Forward), 1× PCR Buffer (Thermo), 2 mM MgCl₂ (Thermo), 0.25 mM dNTPs (Thermo), and 0.5 units of AmpliTaq Gold DNA Polymerase (Thermo), in 20 μL reaction volume. PCR products were detected on a 1.5% agarose ethidium bromide gel. Primer sequences are described in Table S7.

Chalabi S., Legrand A., Michaels V., Palomares M.A., Olaso R., Boland A., Deleuze J.F., Ezine S., Battail C, & Tronik-Le Roux D. (2022). Temporal Gene Expression Profiles Reflect the Dynamics of Lymphoid Differentiation. International Journal of Molecular Sciences, 23(3), 1115.

+ Open protocol

+ Expand

Mitochondrial DNA Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR amplification was carried out in 20-μl volumes containing 10–20 ng of the extracted genomic DNA, 1 × PCR buffer (Applied Biosystems), 2.0 mM MgCl₂, 0.2 mM of each dNTP, 3 pmol of each primer, and 0.5 units of AmpliTaq Gold DNA polymerase (Applied Biosystems). We performed PCR amplification using 23 overlapping fragments of the complete mtDNA^{40 (link)} and variable portions of the control region primers, Cerv.tPro, and CervCRH^{41 (link)}. The thermal cycling conditions for both the primer pair was as follows: an initial hot start at 95 °C of 10 minutes, followed by 35 cycles at 95 °C for 45 seconds, 55 °C for 45 seconds and 72 °C for 1 minute, with a final extension of 72 °C for 15 minutes. The efficiency and reliability of the PCR reactions were monitored using control reactions. The PCR products were electrophoresed on 2% agarose gel and visualized under UV light in the presence of ethidium bromide dye. The amplified PCR products were treated with Exonuclease-I and Shrimp Alkaline Phosphatase (USB, Cleveland, OH) for 15 minutes each at 37 °C and 80 °C, respectively, to remove any residual primer. The purified fragments were sequenced directly in an Applied Biosystems Genetic Analyzer 3500XL from both primers set using a BigDye v3.1 Kit.

Gupta S.K., Kumar A., Angom S., Singh B., Ghazi M.G., Tuboi C, & Hussain S.A. (2018). Genetic analysis of endangered hog deer (Axis porcinus) reveals two distinct lineages from the Indian subcontinent. Scientific Reports, 8, 16308.

+ Open protocol

+ Expand

Comprehensive Mitochondrial DNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polymerase chain reactions (PCRs) amplifications were carried out in 20 μl volumes containing 10–20 ng of extracted genomic DNA containing, 1 × PCR buffer (Applied Biosystems), 2.5 mM MgCl₂, 0.2 mM of each dNTP, 5 pmol of each primer, and 5 units of Taq DNA polymerase (Thermo Scientific). We performed PCR amplification using 23 overlapping fragments of complete mtDNA (Additional file 1: Table S3) [49 (link)]. Besides, we included the fragments of complete Cytochrome b [50 (link)] and Cytochrome c oxidase subunit-I gene [51 (link)] to increase the overlapping. PCR cycles for DNA amplification were 95 °C for 5 min; followed by 35 cycles of 95 °C for 40 s (denaturation), 54–56 °C (annealing) for 40 s, 72 °C for 50 s (extension) and a final extension of 72 °C for 15 min. The efficiency and reliability of reactions were monitored using controls. The PCR products were electrophoresed on 2% agarose gel and visualized under UV light in the presence of Ethidium bromide dye. The amplified PCR products were treated with Exonuclease-I and Shrimp alkaine phosphatase (USB, Cleveland, OH) for 15 min each at 37 °C and 80 °C, respectively, to remove any residual primer. The purified amplicons were then sequenced bidirectionally using BigDye Terminator 3.1 on an automated Genetic Analyzer 3500XL (Applied Biosystems, Carlsbad, CA, USA).

Singh B., Kumar A., Uniyal V.P, & Gupta S.K. (2021). Phylogeography and population genetic structure of red muntjacs: evidence of enigmatic Himalayan red muntjac from India. BMC Ecology and Evolution, 21, 49.

+ Open protocol

+ Expand

Sensitive TTC Repeat Sequence Detection in M. leprae

Check if the same lab product or an alternative is used in the 5 most similar protocols

The primers used for region flanking entire 21 bp TTC repeat sequences were originally designed by Shin et al.[3 (link)] Both the primers were designed based on the M. leprae genome sequences flanking the TTC repeats to make sure that only the M. leprae genomic DNA would anneal with the primers [Table 1], by the polymerase chain reaction (PCR) conditions. Final DNA concentration of 100 ng was measured by spectrophotometer. Genomic DNA was amplified with AmpliTaq Gold, (Applied Biosystems, Inc., Foster City, CA) in a PCR reaction mixture, containing 1×PCR buffer (Applied Biosystems), 200 microM MgCl₂, 2.5 mM each dNTP, and 20 picomoles of each primer TTC-A/TTC-B. The primer sequences, primer annealing temperature (Ta°), and PCR product sizes are given in Table 1. The PCRs were performed in the following conditions: 95°C 4 min, followed by 35 cycles of 95°C for 1 min, Ta° of the primer annealing [Table 1] for 1 min, 72°C for 1 min, and then 72°C for 10 min for the final extension. The amplified products were separated by electrophoresis on 2% agarose gel stained with 0.5 mg/mL ethidium bromide and visualized and photographed under an ultraviolet transilluminator.
The amplified PCR products were then subjected to sequencing. Mutations in rpoB and folP1 gene were determined as described previously by Lavania et al.[15 (link)]

Reja A.H., De A., Patra P.K., Biswas S., Duttagupta U., Sil A., Biswas N., Bannerjee S., Sarda A, & Bhattacharya B. (2018). Genomic Reduction at TTC Repeats in the Bacterial Genome of Treated Cases of Hansen's Disease: A Possible Survival Mechanism of Mycobacterium leprae. Indian Journal of Dermatology, 63(6), 449-454.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Amplification

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from each pure culture using QIAamp DNA mini kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions. The PCR amplifications were performed using universal primers 27F (5′ AGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′ TACGGCTACCTTGTTACGACTT 3′) [40 (link)] targeting 16S rRNA gene sequences. Polymerase Chain Reaction (PCR) was performed with a reaction mixture containing 1x PCR buffer (Invitrogen), 0.5 μM of each primer, 2.5 mM MgCl₂, 200 ng of purified DNA, 0.2 mM dNTPs, and 0.3 units of Taq polymerase (Invitrogen). The total volume was adjusted to 25 μL. The PCA media and ddH₂O were used as negative controls. Samples were amplified according to the following cycle: initial denaturation at 94°C for 10 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min. The final extension was at 72°C for 8 min.
The amplified product was visualized on a 1% agarose gel containing ethidium bromide using a UV transilluminator. The PCR amplicons were then purified using the QIAquick PCR Purification Kit (Qiagen). The purified products were sent to Macrogen, South Korea (Macrogen Inc., 1001, 254 Beotkkot-ro, Geumcheon-gu, Seoul, Republic of Korea) for 16S ribosomal RNA partial gene sequencing by the Sanger method.

Gunathilaka N., Ranasinghe K., Amarasinghe D., Rodrigo W., Mallawarachchi H, & Chandrasena N. (2020). Molecular Characterization of Culturable Aerobic Bacteria in the Midgut of Field-Caught Culex tritaeniorhynchus, Culex gelidus, and Mansonia annulifera Mosquitoes in the Gampaha District of Sri Lanka. BioMed Research International, 2020, 8732473.

+ Open protocol

+ Expand

16S rDNA Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Amplification of the 16S rDNA gene was carried out with universal primers SD-Bact-0008-a-S-20 and S-D-Bact-1495-a-S-20 [32 (link)]. Each reaction tube contained 1x PCR buffer (Invitrogen), 0.5 μM of each primer, 2.5 mM MgCl₂, 200 ng of purified DNA, 0.2 mM dNTPs and 0.3 units of Taq polymerase (Invitrogen) and the total volume was adjusted to 25 μl. Samples were amplified according to the following cycle: an initial denaturation step at 94°C for 10 min, followed by 35 cycles at 94°C for 1 min, 55°C for 1 min, 72°C for 1 min and a final extension step of 10 min at 72°C, using an ABS2720 thermocycler. PCR amplicons were then purified using the QIAquick PCR Purification Kit (Qiagen) and sequenced.

Fraihi W., Fares W., Perrin P., Dorkeld F., Sereno D., Barhoumi W., Sbissi I., Cherni S., Chelbi I., Durvasula R., Ramalho-Ortigao M., Gtari M, & Zhioua E. (2017). An integrated overview of the midgut bacterial flora composition of Phlebotomus perniciosus, a vector of zoonotic visceral leishmaniasis in the Western Mediterranean Basin. PLoS Neglected Tropical Diseases, 11(3), e0005484.

+ Open protocol

+ Expand

Bacterial ITS Region Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The length and sequences polymorphisms of the Intergenic Transcribed Spacers (ITS), located between the 16S and 23S rRNA, is quite often due to the presence of tRNA genes. PCR amplification of the 16S-23S intergenic transcribed spacer regions between the rRNA genes (ITS) was performed for screening the bacterial phylotype diversity [29 (link)–31 ]. The universal primers, ITSF (5’-GTCGTAACAAGGTAGCCGTA-3’) and ITSR (5’-CAAGGCATCCACCGT-3’), are complementary to nucleotide (nt) positions 1423–1443 of the 16S rDNA and nt positions 38–23 of the 23S rDNA of Escherichia coli, respectively [30 ]. Each reaction tube contains 1X PCR buffer (Invitrogen), 2 mM MgCl₂, 0.2 mM deoxynucleoside triphosphate mix, 0.1 μM of each primer, 0.5 U of Taq polymerase (Invitrogen) and 400 ng of DNA extracted from single colonies. The total volume was adjusted to 25 μl. Amplification parameters were as follows: initial denaturation at 94°C for 5 min, followed by 35 cycles at 94°C for 30 s, 50°C for 30 s, 72°C for 45 s, with a final extension step of 10 min at 72°C, using an ABS2720 thermocycler.

+ Open protocol

+ Expand

Invertebrate COI Barcoding Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The primers LCO1490 5′-GGTCAACAAATCATAAAGATATTGG-3′ and HCO2198 5′-TAAACTTCAGGGTGACCAAAAAATCA-3′ [72 (link)] were used to amplify the COI gene barcode region, according to Bourke et al. [35 (link)]. Each reaction was performed in a total volume of 25 μL containing 2 μL of DNA, 1× PCR buffer (Invitrogen), 1.5 mM MgCl2 (Invitrogen), 0.2 mM of each dNTP (Amresco), 0.1 μM of each primer, and 0.625 U of Taq Platinum polymerase (Invitrogen), and the remaining volume consisted of ultrapure water. The PCR thermal conditions consisted of 94 °C for 3 min, five cycles of 94 °C for 30 s, 45 °C for 90 s, 68 °C for 60 s, followed by 35 cycles of 94 °C for 30 s, 51 °C for 30 s, 68 °C for 60 s, and a final extension at 68 °C for 10 min. PCR products were purified by PEG precipitation (20% polyethylene glycol 8000/2.5 M NaCl).

Amorim J.A., de Oliveira T.M., de Sá I.L., da Silva T.P, & Sallum M.A. (2023). DNA Barcodes of Mansonia (Mansonia) Blanchard, 1901 (Diptera, Culicidae). Genes, 14(6), 1127.

+ Open protocol

+ Expand

Bacterial 16S rRNA Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 8

Small-subunit ribosomal genes (16S) will be amplified using universal 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 1391R (5′-GACGGGCGGTGWGTRCA-3′) primers for bacterial 16S rRNA genes. The PCR reaction will contained 1×PCR Buffer from Invitrogen, 2.5 mM MgCl₂, 0.2 μM of each primer, 0.2 μM dNTPs, 0.5 U Taq DNA polymerase by Invitrogen™ and 1.0 μl template DNA. Amplification will be accomplished by initial denaturation at 94° C. for 3 minutes followed by 2S cycles of 94° C. for 30 seconds, 50° C. for 30 seconds and 72° C. for 30 seconds with a final extension at 72° C. for 10 minutes. Each DNA sample will be amplified in triplicate and the amplicons will be pooled by plot and run on a 1.5% agarose gel. The bands will be purified using the Promega™ Wizard® SV Gel and PCR Clean-Up System. The sample will be then ready for sequencing.

US10975691B2. Microbiome based systems, apparatus and methods for the exploration and production of hydrocarbons (2021-04-13). Biota Technology, Inc. [US]. Inventors: Rob Knight [US], Ajay Kshatriya [US], John Ely [US], Paul Henshaw [US], J. Gregory Caporaso [US], Dan Knights [US], Ryan Gill [US].

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!