RT-PCR/qRT-PCR were performed as described previously [15 (link)]. Transcript abundance was normalized against actin5C mRNA. RT was performed with M-MLV RT (Promega). PCR products were run on 1% agarose gel to visualize DNA. qRT-PCR was done using SYBR Fast qPCR kit master mix (2x) universal (Kapa Biosystems, USA) and on the Applied Biosystems 7900HT Fast Real-Time PCR system. Oligonucleotides used were rpl10ab sisR Fw GTACGTTGGCTAAGTCACCTGCGCA, rpl10ab sisR Rv TTGGCCAGCTTCTTCACCAGCTTCT, RpL10Ab spliced Fw TGCAGATCGGCCTGAAGAACTACGA, RpL10Ab spliced Rv CAATGCTGCTGATCGCCAAGGATGCA, RpL10Ab pre-mRNA fwp GTAAGTTTTCCATGAGGCCCCACTT, RpL10Ab pre-mRNA rvp CAGCTTCTTCACCAGCTTCTTGTTC, actin5C Fw TGCCCATCTACGAGGGTTAT, actin5C Rv AGTACTTGCGCTCTGGCGG.
Sybr fast qpcr kit master mix 2x universal
Manufactured by Roche
Sourced in United States
The SYBR Fast qPCR kit master mix (2x) universal is a laboratory reagent designed for use in quantitative real-time PCR (qPCR) applications. It contains all the necessary components, including SYBR Green I dye, for the amplification and detection of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
M mlv rt, by Promega (2 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Abi 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
All in one rt mastermix, by Applied Biological Materials (1 mentions)
7500 fast rt pcr system, by Thermo Fisher Scientific (1 mentions)
Direct zol rna miniprep kit, by Zymo Research (1 mentions)
Primescript first strand cdna synthesis kit, by Takara Bio (1 mentions)
Cfx96 touch, by Bio-Rad (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
8 protocols using sybr fast qpcr kit master mix 2x universal
1
Quantitative RT-PCR Analysis of Drosophila Gene Expression
2
Quantitative RT-PCR Analysis of MuSK and NGR1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used QRT-PCR to evaluate the RNA according to the fluorescence value of the amplified exponential phase. Samples were homogenized in Trizol reagent (15596-018, Invitrogen, USA), and total RNA was extracted according to the manufacturer's instructions. Subsequently, RNA was reverse transcribed (Revertaid First Strand cDNa Synthesis Kit, Thermo Scientific K1622, USA), and qRT-PCR was carried out with an ABI 7900HT Sequence Detection System (Applied Biosystems, USA) using SYBR green (SYBR FAST qPCR Kit Master Mix (2x) Universal, KAPA Biosystems, USA). Relative expression was determined by simultaneous comparison to the “housekeeping” gene, actin, using the geNorm software (v3.5, Ghent, Belgium). Transcriptions for MuSK and NGR1 were assessed. The primer sets used for PCR amplification were as follows: Actin-F1, CACACTCCCGCTCAGCTCAC and Actin-R1 GCTTGCTCTGGGCCTCGT; NGR1-F, CTTCGCTGTGAGACCAGTTCAG and NGR1-R CCAGTGATGCTTTGTTGATGC; Musk-F TGTTCTCCTGCCTGAGCCTG and Musk-R TTGCGGGTAGGATTCCACTG.
3
Quantitative RT-PCR Analysis of ANGPTL3 and LPL
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a Direct-zol RNA MiniPrep kit (Zymo Research, USA) according to the manufacturer’s instructions. Total mRNA (1 µg) was reverse transcribed using 5X All-In-One RT MasterMix (Abm, Canada) according to the manufacturer’s instructions. Real-time PCR (RT–PCR) was performed using SYBR FAST qPCR Kit Master Mix (2X) Universal (KAPA, USA) on an Applied Biosystems 7,500 Fast RT–PCR System (Foster City, USA). The RT–PCR mixture included cDNA (1.0 µl), 2X SYBR‑Green Mix (10 µl), forward primer (10 µM, 0.5 µl), reverse primer (10 µM, 0.5 µl), and RNase‑free water in a final volume of 20 µl. The reaction conditions were as follows: 2 min of denaturation at 94°C, 40 cycles of 1 min at 94°C, 30 sec at 56°C, and 2 min at 72°C, and a final extension step at 72°C for 10 min. The cycle threshold (Ct) values were analyzed using the comparative Ct (ΔΔCt) method according to the MIQE guidelines. The amount of the target was normalized to an endogenous reference (GAPDH) and is expressed relative to the control (nontreated cells). The primers used were as follows: ANGPTL3 (forward, 5’- GCGAACATACAAGTGGCGTG-3’; reverse, 5’-CTGTGAGCCATCT TTCCGGT-3’) and LPL (forward, 5’- GAAAACCCCAGC AAGGCATAC -3’; reverse, 5’- CATCTTGCTGCTTCTCTTGGC -3’).
4
Transcriptional Analysis of sisR-1 and DIP1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR/qRT-PCR were performed as described previously29 (link),53 (link). Transcript abundance was normalized against actin5C mRNA. RT was performed with M-MLV RT (Promega). PCR products were run on 1% agarose gel to visualize DNA. qRT-PCR was done using SYBR Fast qPCR kit master mix (2x) universal (Kapa Biosystems, USA) and on the Applied Biosystems 7900HT Fast Real-Time PCR system. Oligonucleotides used were sisR-1 Fw TCATGGAATCAGAAGCCCGT, sisR-1 Rv GGTTGTAAGCGTGGTGTCTC, DIP1 Fw TAATACGACTCACTATAGGGAGAAAGAAGTTGCGACAGAACCG, DIP1 Rv TAATACGACTCACTATAGGGAGACGAACAGCTTGTAGATGGCA, actin5C Fw TGCCCATCTACGAGGGTTAT, actin5C Rv AGTACTTGCGCTCTGGCGG, Rp49 Fw CCAAGGACTTCATCCGCCACC, Rp49 Rv GCGGGTGCGCTTGTTCGATCC.
5
Quantitative Real-Time PCR for GATA-3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated from lung tissues using Trizol reagent. The total RNA (1 μg) was directly reverse-transcribed using a PrimeScript First Strand cDNA Synthesis Kit (RR037A, TaKaRa, Shiga, Japan) according to the manufacturer’s protocol. The reverse transcription reaction was incubated at 37℃ for 15 minutes, inactivated at 85℃ for 5 seconds, and then cooled at 4℃. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using a SYBR FAST qPCR Kit Master Mix (2X) Universal (KR0389, KAPA biosystems, Boston, MA, USA) with forward and reverse primers for GATA-binding protein-3 (GATA-3) and GAPDH. The primer sequences used were as follows: GATA-3 sense, 5- TCATTAAGCCCAAGCGAAGG-3; GATA-3 anti-sense, and 5- GTCCCCATTGGCATTCCTC-3. PCRs were carried out in a real time PCR Machine (CFX96 Touch) (Bio-Rad, Irvine, CA, USA). The samples were incubated at 95℃ for 3 minutes, followed by 40 cycles at 95℃ for 5 seconds and then at 60℃ for 30 seconds. Each sample was amplified in duplicate. The fold change of test gene mRNA was expressed as 2-ΔΔCt (ΔCt = the difference in threshold cycles for the test gene and GAPDH, ΔΔCt = the difference of ΔCt between stimulated and non-stimulated control).
6
RT-PCR Analysis of Inflammatory Markers in LPS-Stimulated Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR assay was performed as previously described [17 (link)]. RAW264.7 macrophages were seeded in 6-well plates at a density of 1.2 × 107 cells per well overnight. The cells were pretreated with Cl-EE for 1 h and then exposed to LPS (10 ng/mL) for a further 4 h. Total RNA was extracted by using TRIzol and RT-PCR was performed by using a KAPA SYBR® FAST Universal 2X qPCR Master Mix kit. The cycling conditions were as follows: 95 °C for 20 s, 40 cycles of 95 °C for 15 s and 60 °C for 20 s. The mRNA levels of iNOS, TNF-α, MCP-1, IL-1β, and IL-6 were normalized to GAPDH, a stable housekeeping gene. The primer information used in this study was listed in Table 1 .
Sequences of primers used in the RT-PCR analysis
| Targets | Direction | Primer sequences |
|---|---|---|
| iNOS | F | 5’-CTC AGC CCA ACA ATA CAA G-3’ |
| R | 5’-CTA CAG TTC CGA GCG TCA-3’ | |
| IL-6 | F | 5’-CTG CAA GAG ACT TCC ATC CAG-3’ |
| R | 5’-AGT GGT ATA GAC AGG TCT GTT GG-3’ | |
| MCP-1 | F | 5’-GCC CCA CTC ACC TGC TGC TAC T-3’ |
| R | 5’-CCT GCT GCT GGT GAT CCT CTT GT-3’ | |
| IL-1β | F | 5’-GCA ACT GTT CCT GAA CTC AAC T-3’ |
| R | 5’-ATC TTT TGG GGT CCG TCA ACT-3’ | |
| TNF-α | F | 5’- GCC TAT GTC TCA GCC TCT T-3’ |
| R | 5’- GGT TGA CTT TCT CCT GGT AT-3’ | |
| GAPDH | F | 5’-GGT TGT CTC CTG CGA CTT CA-3’ |
| R | 5’-TGG TCC AGG GTT TCT TAC TCC-3’ |
F forward, R reverse
7
Quantitative Real-Time PCR Analysis of EAE Microglia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differential expression of the Mpeg1 and B2m transcripts between naïve and acute EAE microglia was experimentally verified by quantitative real-time PCR (qRT-PCR, SYBR Fast Universal 2X qPCR Master Mix Kit, KK4601, Kapa Biosystems), employing the 2-ΔΔCt method and using Gapdh for data normalization. The following primer sets were used: mo-qMpeg1-F: TGGCAGATCAAGCAGTATGG, mo-qMpeg1-R: CTCACTGTGACTTGCGCATT, mo-qB2m-F: GCCGAACATACTGAACTGCT, mo-qB2m-R: CTTGATCACATGTCTCGATCCC, mo-GAPDH-F: ACTCCACTCACGGCAAATTC, mo-GAPDH-R: TCTCCATGGTGGTGAAGACA. Reactions were performed using 10 ng cDNA as template and 0.7 μM of each primer in a final volume of 14 μL. Thermal cycling and data acquisition were performed in a 7500 Fast Real-Time PCR System (Applied Biosystems), under the following conditions: initial denaturation at 95 °C for 2 min, 40 cycles consisting of denaturation for 5 s at 95 °C, annealing at 60 °C for 20 s, and extension at 72 °C for 20 s. All reactions were set in triplicates.
8
CACNA1C Expression Quantification by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CACNA1C expression in the tested human autopsy samples was determined through quantitative real-time PCR (qRT-PCR), using the SYBR Fast Universal 2X qPCR Master Mix Kit (Kapa Biosystems, Cat No KK4601) and the 2-ΔΔCt method for relative quantification. GAPDH expression was used for normalization. Reactions were performed under default settings, in an ABI 7500Fast thermal cycler, in a final volume of 20 μl, using 20 ng cDNA and 0.1 μΜ of each primer. The following primer sets were used: hu-CANA1C-qRT-F: 5′ TGATTCCAACGCCACCAATTC 3′, hu-CANA1C-qRT-R: 5′ GAGGAGTCCATAGGCGATTACT 3′ and GAPDH-F: 5′ CAG CCTCAAGATCATCAGCA 3′, GAPDH-R: 5′ TGTGGTCATGAGTCCTTCCA-3′.
Correlation analysis between CACNA1C expression and editing levels was performed using the GraphPad Prism software v9.0.0.
Correlation analysis between CACNA1C expression and editing levels was performed using the GraphPad Prism software v9.0.0.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!