The total RNA of the liver was extracted by the commercial kit RNAiso PLUS produced by TaKaRa. RNA was quantified using a Nanodrop 2000 UV-spectrophotometer. The genomic DNA was eliminated by the incubation of total RNA with the Eraser of gDNA. RNA was reverse transcribed with the PrimeScript™ RT reagent kit for real-time PCR. Specific primers for qPCR were designed by primer 6.0 (Table 2 ). SYBR® Green from Vazyme was used for the qPCR amplification on a quantitative thermal cycler (LightCycler 480 II, Switzerland). The qPCR program was as follows: 95°C for 3 min, then 40 cycles of 95°C for 12 s, 57°C for 12 s, and 72°C for 25 s. Comparative 2−△△Ct method was used in the analysis of relative fold changes of genes which were normalized to the reference gene 18S rRNA.
Lightcycler 480 2
Manufactured by Vazyme
Sourced in Switzerland
The LightCycler 480 II is a real-time PCR system designed for quantitative nucleic acid analysis. It features a high-performance optical system, advanced temperature control, and intuitive software to enable reliable and efficient real-time PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Rnaiso plus, by Takara Bio (1 mentions)
Sybr green, by Vazyme (1 mentions)
Qpcr kit, by Vazyme (1 mentions)
Primescript rt reagent kit for rt pcr, by Takara Bio (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Chamq sybr qpcr master mix, by Vazyme (1 mentions)
Sybr qpcr mix, by Vazyme (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
4 protocols using lightcycler 480 2
1
Liver Total RNA Extraction and qPCR Analysis
2
Transcriptome Analysis of Trichoderma chinensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA sample used for transcriptome sequencing as the material, cDNA was synthesized by reverse transcription using qPCR kit (Vazyme), and qRT-PCR analysis was performed using LightCycler480II type fluorescence quantitative PCR instrument. The reference gene was 18SrRNA from Trichodermachinensis. Relative gene expression was calculated by 2−∆∆Ct method. Specific primer information was shown in Table 1 .
PCR primer used in this study.
| Gene symbol | Forward primer | Reverse primer |
|---|---|---|
| radR | AAAGTCTTGGGCCTTTGC | GGTATTTGTCCGCCAAACTG |
| 65E11.140 | TGGTCGAACTCCGAGGACAA | GTTTCAGCTATATGAACCCAGT |
| T16L24.250 | GATCTGTCCGGCTGGATT | TGCAACATCGCGGAGAAC |
| CYP205 | TATCAAGACTCCAGGCAAGG | CTGATAGTTGCTTGACACAG |
| tyr1 | TGCGTGGTGGAGCATGAA | ATCCACAACGGAATACACTG |
| YCR10C | TGCAGAGCAGGCTTACAC | CTTGAGAGACCATGGACTGA |
| YHR009C | ATGGAGCGCAACATTGTC | GGGTTGAATTTGGGATGGC |
| ATEG_00912 | CGAGATCCAACGGAATCAC | TCATGTAGCGCAGATGCAC |
| CaO19.10303 | CTTTACCCAGCTTGTCTGGA | ACACAACAATGGTACGCC |
| SPBC29A10.02 | TCGCTCTGCCTACACAAC | TTGAAATGGCCGACTTGG |
| Ophiocordycepssinensis18S | GCAGTGGCATCTCTCAGTC | TCATCGATGCCAGAACC |
3
Quantitative analysis of α7nAChR expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the lung tissue by using a TRizol reagent (Sigma-Aldrich). cDNA was synthesized using a PrimeScript RT Reagent kit for RT-PCR (TAKARA BIO INC, Japan). qPCR analysis of α7nAChR and GAPDH was performed in the Real-time Detection System Roche LightCycler480 II, Switzerland by ChamQSYBR qPCR Master Mix (Vazyme, Nanjing, China) detection. Equal amounts of RNA (500 ng) were used to prepare cDNA. The primers used were as follows: α7nAChR, sense GGCAAAATGCCTAAGTGGAC, antisense CTTCATGCGCAGAAACCAT; GAPDH, sense AACTTTGGCATTGTGGAAGG, antisense CACATTGGGGGTAGGAACAC. The fold change of the target gene cDNA relative to GAPDH was determined as follows: fold change = 2−ΔΔCt, where ΔΔCt = (Ct Target-Ct GADPH) test − (Ct Target-Ct GADPH) control. GAPDH served as an internal standard control for variations in RT-PCR efficiency.
4
Soybean Seed Development: qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The seed of qRT-PCR material was sampled according to different developmental stages of soybean seeds. The Cotyledon Stage (COT, 10 days after flowering (DAF)) and Early Maturity Stage 1(EM1, 20 DAF) mainly carry out cotyledon development and endosperm assimilation. Then, the seed size and weight are increasing at Early Maturity Stage 2(EM2, 30 DAF) and Mid Seed Maturity (MM, 50 DAF).2 During the COT, EM1, EM2, and MM of seed in parents SN14, CSSL-R183, and wild soybean ZYD00006 (Severin et al., 2010 (link); Collakova et al., 2013 (link); Lu et al., 2016 (link)), soybean seed RNA was extracted by TRIzol (Invitrogen, 15596-026, Carlsbad, CA, United States). qRT-PCR was carried out on a Roche LightCycler 480 II fast real-time PCR system using SYBR qPCR Mix (Vazyme, Q711, Vazyme Biotech, Nanjing, China). Actin (GLYM18G52780) was used as the internal reference (Gu et al., 2017 (link)), and the relative amount of gene expression (target gene/actin) was calculated by the 2ΔCT method. Premier 5.03 was used to design qRT-PCR primer sequences for candidate genes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!