Spike in control

Total RNA was extracted from 200 μL of serum using the miRNeasy Serum/Plasma Kit (Qiagen, Gaithersburg, MD, USA) according to the manufacturer’s protocol. “3.5 μl of Spike-In Control (C. elegans miR-39 mimic, QIAGEN Cat. 219610) was added to each extraction as an internal control.” The RNA concentration and purity were evaluated using the DeNovix DS-11 Spectrophotometer (DeNovix Inc, Wilmington, DE).

The total RNA in 50 μl plasma was mixed with QIAzol Lysis Reagent at a 1:5 ratio with C. elegans miR-39 miRNA mimic as a Spike-In Control (Qiagen Pty, Doncaster, VIC, Australia). The RNA was then extracted with the miRNeasy Serum/Plasma Kit (Qiagen), according to the manufacturer’s protocols. Purified RNA was converted into cDNA using miScript II RT Kit (Qiagen).

The expression level of selected miRNA in tissue and serum was quantified by qRT-PCR. Total 1.0 µg miRNA from tissue and total miRNA from serum samples were polyadenylated using poly(A) polymerase and reverse transcribed using miScript^® II RT Kit (Cat. No. 218160, Qiagen) following the instruction of the manufacturer. Furthermore, complementary DNA (cDNA) was diluted to bring the final concentration to 8 ng/µl for subsequent real-time qPCR reaction and stored at −80°C. The quantitative expression analysis of selected miRNA was performed according to SYBR^® Green PCR Kit (Cat. No. 218073, Qiagen) with target miRNA primer (miScript Primer Assay, Cat. No. 218300, Qiagen, India) using StepOne™ Plus Real-Time PCR machine (Applied Biosystems). All qRT-PCR reaction was performed in triplicate as per the protocol of the manufacturer with the following cycling conditions: initial activation step for 15 min at 95°C, three-step cycling includes denaturation at 94°C for 15 s, annealing at 55°C for 30 s, and extension at 70°C for 30 s, for 40 cycles. For normalization, miRNA-191 was taken as an endogenous control for tissue miRNAs, while cel-miR-39 (Spike-In Control, Qiagen) and miRNA-191 were combined to normalize serum miRNA. The equation used for the normalization of serum miRNA was ΔCt (Ct_miRNA − 0.5 * (Ct_cel-miR-39 + Ct_miR-191) (25 (link)).

Total RNA was isolated from concentrated CdM, exosomes, MSCs, and HUVECs using miRNeasy Micro Kit (Qiagen). Briefly, 200 μl CdM, exosome pellet or cell pellet was lysed by 1 ml QIAzol Lysis Reagent. After 5 min incubation for homogeneity, 3.5 μl of Spike-In control (ce-miR-39, 1.6 × 10⁸ copies/μl working solution, Qiagen) were added, mixed thoroughly, and shaken for 15 seconds and then 200 μl of chloroform were added. The mixture was centrifuged for 15 minutes at 12,000 × g at 4°C following incubation for 2 min. Subsequent upper aqueous phase extraction and filter cartridge work were performed following manufacturer's instructions. cDNA synthesis and quantitative PCR was performed using miScript PCR Starter Kit (Qiagen). In brief, 1 μg total RNA from each preparation was used for the first-strand cDNA reverse transcription in the 20 μl system. Real-time PCR was performed with specific primers in iQ5 real-time PCR system (Bio-Rad) according to miScript SYBR Green PCR Starter Kit's recommendations. Data were normalized to results obtained with primers specific for U6 or in case of CdM and exosomes using synthetic Spike-In control (Ce-miR-39) as an internal control.

All reagents are available from Sigma-Aldrich unless otherwise stated and should be of analytical grade or higher. RNase A and RNase inhibitor, RiboLock were from Thermo Scientific. Protease inhibitor, cOmplete ULTRA Tablets, Mini, EDTA-free EASYpack was from Roche. Antibodies against VAMP-2 and DBH were from Synaptic Systems (Göttingen, Germany). Antibodies against SDHA was purchased from Abcam (Cambridge, MA). Lipids were from Avanti (Alabaster, AL). RNA isolation kit, miRNeasy Mini Kit (Qiagen, cat. no. 217004). cDNA synthesis kit, miScript RT II kit (Qiagen, cat. no. 218161). Synthetic Caenorhabditis elegans miR-39 (syn-cel-miR-39), spike-in control (Qiagen, cat. no. 219610). Synthetic miR-375 (Syn-bta-miR-375), miScript miRNA Mimic (Qiagen, cat. no. 219600). Primer for cel-miR-39, UCACCGGGUGUAAAUCAGCUUG (Qiagen cat. no. MS00019789). Primer for bta-miR-375; UUUUGUUCGUUCGGCUCGCGUGA (Qiagen cat. no. MS00053865). miScript SYBR Green PCR Kit (Qiagen, cat. no. 218073).