Normal mouse igg

ChIP assays were performed as previously described (62 (link)). Briefly, frozen ARC punches were sonicated (9 rounds X 10 secs) in cell lysis buffer after 10-minute formaldehyde cross-linking. Sheared chromatin fragments (200–1000 bp) were incubated in ChIP dilution buffer with anti-H3K9me2 or anti-H3K27me2 (3 μg/sample; Cell signaling, Temecula, CA, USA). Normal mouse IgG (1 µg/sample; Cell Signaling) was used for mock immunoprecipitation (background). DNA was isolated from each immunoprecipitate and subjected to qPCR using the following primers (5′→3′): AgRP: F- aggaagtagtcacgtgtggg, R- ggacacagctcagcaacatT, AgRP (+2000 base pair downstream): F- CCTAGGTCAGTTGAGTGGCA, R- GCCACTTCTTGCTTTCCCAA). Results were normalized to input samples that were not precipitated.

The cDNA sequences of wild-type nsP3 and nsP3 M358L were chemically synthesized (GENEWIZ, Suzhou, China) with a 3×flag tag. The two gene fragments were inserted into the pEZ-Lv206 vector, which were used to generate lentiviral particles for transferring wild-type and mutant nsP3 protein to mammalian cells (GeneCopoeia). In the presence of polybrene, HCT-116 cells were infected by the lentiviral particles (MOI = 1). Cells cultured 72 h post-transduction and selected against with Puromycin(0.5 μg/ml) (Thermo Fisher Scientific), and the expression of mCherry was detected with a fluorescence microscope. Then, total protein was extracted. The protein concentration was quantified with a BCA protein assay kit (Thermo Fisher) and adjusted to a concentration of 2 mg/mL for the following coimmunoprecipitation experiments. One microgram of a mouse monoclonal anti-FLAG antibody (#F3165, Sigma) or normal mouse IgG (#5415, Cell Signaling Technology) was added to each sample and incubated in a swing-type incubator overnight at 4 °C. Protein A/G (Bimake) beads were used to precipitate the interacting protein complexes, which were subsequently analyzed by mass spectrometry (Shanghai Applied Protein Technology).

To determine whether tau interacts with ERα, Co-IP analysis was conducted, using cortical protein lysates from postmortem brain tissues of AD patients and matched control subjects. Samples of frozen cortical gray matter of AD and control were homogenized in RIPA buffer containing protease inhibitors (Cell Signaling) on ice and centrifuged for 10 min at 16,000 × g at 4 °C. 500 ug of lysate was incubated with 20 ul of tau-5 antibody (Abcam) using Dynabeads® Protein G—CoIP Kit (Invitrogen) following the manufacturer’s protocol. Negative controls included IP with normal mouse IgG (Cell Signal). Input and IP samples were run on SDS-PAGE and western blot was performed using the ERα antibody and tau-5.

We used an RIP assay to directly confirm the interaction between miR-122 and Sirt1 according to a method in a previous report (Chen et al., 2018 (link)). Briefly, HepG2 and Huh-7 cells were lysed in 300 μL of lysis buffer supplemented with RNase inhibitor and complete protease inhibitor for 20 min on ice, and then the cell lysate was centrifuged for 10 min at 4 °C. The supernatant was collected and pre-cleared with protein A-Sepharose beads. Next, the supernatant was incubated with mouse anti-human Ago2 antibody (Cell Signaling Technology, USA) or negative control antibody (normal mouse IgG, Cell Signaling Technology, USA) for 4 h, followed by the addition of protein A/G sepharose beads and incubation for 2 h. The beads were then rinsed with NT2 buffer supplemented with RNase inhibitor and complete protease inhibitors, and bead-captured protein-RNA complexes were digested using DNase I and proteinase K and were then eluted by NT2 buffer. RNA was finally extracted by the phenol-chloroform method and quantified by qRT-PCR. The primers used for amplifying the Sirt1 were as follows: forward: 5′-TTTGTCAGAGTTGCCACCCA-3′; reverse: 5′-GCCGCCTACTAATCTGCTCC-3′.

ChIP and Re-ChIP assays were performed using the ChIP-IT^® Express Chromatin Immunoprecipitation Kits and Re-ChIP-IT^® kits (Active Motif), according to the manufacturer’s instructions. Chromatin samples were immunoprecipitated with either anti-RelA antibody (Cell Signaling Technology) or normal mouse IgG (Cell Signaling Technology) as a negative control. Precipitated DNA was amplified by PCR using primers provided in the Additional file 1: Table S1. Non-immunoprecipitated chromatin fragments were used as an input control.

Immunoprecipitation of p62/SQSTM1 was performed using Dynabeads Protein A (Invitrogen, CA, USA) according to the manufacturer's protocol. MV4-11 cells were lysed using a cold cell lysis buffer with a protease inhibitor cocktail (Beyotime, Shanghai, China) on a rotator for 1 h and then centrifuged at 4°C for 10 min. The supernatants were incubated with anti-p62 antibody or IgG and then rotated at 4°C overnight. The protein A-Sepharose suspension was added and rotated at 4°C for 2 h. The supernatants were discarded after the magnetic beads aggregated, and the magnetic beads were washed 3 times with NETN (900 mmol/L NaCl) and then added to the protein lysate and loading buffer. Finally, the samples were analyzed by western blotting. Western blotting was performed as previously described. The samples were separated with a 10% polyacrylamide gel, transferred to a PVDF membrane (Millipore, Beijing, China) and probed with antibodies. Anti-Flt3, anti-phospho-Flt-3 (Y591), anti-Atg5, anti-Atg7, anti-p62/SQSTM1, anti-LC3B, anti-GAPDH, and normal mouse IgG were obtained from Cell Signaling Technologies (Beverly, MA, USA).