The largest database of trusted experimental protocols

5 protocols using poly a u

1

Zika virus infection in cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
For infection, Vero, C6/36 cells and MoDCs were seeded in tissue culture plates 24 h prior to infection with ZIKV. Cells were washed once with pre-warmed phosphate-buffered saline solution (PBS) (Gibco) and ZIKV, diluted with culture medium without supplements, was added to reach the desired MOI. Based on preliminary experiments with two ZIKV strains in Vero and C6/36 cells, we selected a MOI of 0.1 TCID50/cell to perform the African and Asian lineage strain comparison. Indeed, already at 24 h post infection at MOIs < 1 TCID50/cell, we detected significant frequency of ZIKV-positive cells and high titers of live virus in supernatants. The virus was adsorbed for one hour at 37 °C or 28 °C. Next, the inoculum was discarded and the cells were washed three times with pre-warmed PBS. Fresh culture medium was added to each well and the cells were incubated at 37 °C or 28 °C, 5% CO2 until harvesting. As controls, the culture supernatant from uninfected C6/36 cells was used for mock infection and Poly(IC) (30 µg/ml) (Sigma-Aldrich) in combination with Resiquimod (10 µM) (Sigma-Aldrich), Poly(AU) (0.1 µg/ml) (Sigma-Aldrich) and 5′ppp-dsRNA (1 µg/ml) (InvivoGen) were used as TLR ligands.
+ Open protocol
+ Expand
2

Apoptosis Induction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Poly I:C and poly A:U were both obtained from Sigma (St. Louis, Missouri, USA). The human agonistic anti-Fas antibody CH11 was obtained from Merck-Millipore, (Billerica, MA, USA), with murine agonistic anti-Fas antibody Jo2 obtained from BD Biosciences (San Jose, CA, USA). Staurosporine was obtained from Sigma.
+ Open protocol
+ Expand
3

E. coli Protein Purification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
E. coli BL21(DE3) cells and plasmid pET22b(+) were from EMD Millipore. 6‐FAM–dArUdAdA–6-TAMRA, 5,6-FAM–d(CGATC)(rU)d(ACTGCAACGGCAGTAGATCG), and DNA oligonucleotides for PCR, sequencing, and mutagenesis were from Integrated DNA Technologies. Poly(A:U) was from Sigma Chemical; low-molecular-weight poly(I:C) was from InvivoGen. Sulfatides, phosphatidylserine, and cetyltrimethylammonium bromide (CTAB) were from Avanti Polar Lipids.
Protein purification columns were from GE Healthcare. Restriction and PCR enzymes were from Promega. 96-Well plates were from Corning. 2-(N-Morpholino)ethanesulfonic acid (MES) was purified to be free of oligo(vinylsulfonic acid) [42 (link)]. All other chemicals were of commercial grade or better, and were used without further purification.
The molecular mass of each ribonuclease was determined by matrix-assisted laser desorption/ionization-time-of-flight (MALDI–TOF) mass spectrometry with a Voyager-DE-PRO Biospectrometry Workstation from Applied Biosystems at the campus Biophysics Instrumentation Facility. All fluorescence and absorbance measurements were made with a M1000 fluorimeter plate reader from Tecan, unless stated otherwise. All data were fitted and analyzed using Prism 5 software from GraphPad, unless stated otherwise.
+ Open protocol
+ Expand
4

Nucleic Acid Labeling and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Aphidicolin, caffeine, CGK733, cytosine β-D-arabinofuranoside hydrochloride (Ara-C), TransFectin, DMSO, Poly G:C, Poly A:U and Poly I:C were purchased from Sigma. KU55933 and VE-821 were obtained from Tocris Bioscience or Axon Medchem. ODN1585, ODN1668 control (ssDNA), and LPS were purchased from Invivogen. DNA was conjugated to Alexa-488 using the Ulysis-labelling kit according to manufacturer's instructions (Invitrogen).
+ Open protocol
+ Expand
5

Investigating Immune Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pam3CSK4 and LPS were purchased from Enzo Life Sciences/Alexis (Lörrach, Germany). Poly(A:U) and 8-bromoguanosine-3′, 5′-cyclic monophosphate (8-Br-cGMP) were purchased from Sigma. Mouse interferon-β (IFNβ) was sourced from PBL Biomedical Laboratories (Piscataway, NJ, USA). Nitric oxide (NO) synthase inhibitor, Nω-nitro-L-arginine methyl ester (L-NAME) was obtained from Cayman Chemical (Hamburg, Germany). Anti-interleukin-6 (aIL6) monoclonal antibody (clone MP5-20F3, cat#BE0046) and the isotype control (rat IgG1, cat#BE0088) were purchased from Biozol (Eching, Germany).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!