Cdp star ready to use

To validate and characterize the transgenic events, Southern blot analysis was conducted using genomic DNAs isolated from the leaves of transgenic and non-transgenic control plants. Genomic DNAs were digested with EcoRI (New England Biolabs, Ipswich, MA) which cuts once within the T-DNA construct, but not within the region of hptII resistance gene used for the probe (Fig. 4). EcoRI-digested genomic DNAs of each line were electrophoresed through a 1% (w/v) agarose gel and blotted onto a positively charged nylon membrane (Amersham Hybond-N+, GE Healthcare Life Sciences, Pittsburgh, PA) as described in the DIG Application Manual for Filter Hybridization (2008 by Roche Diagnostics GmbH, Mannheim, Germany). The DIG labeled probe (specific to hptII gene) was synthesized using the PCR DIG Probe Synthesis Kit. All labeling, hybridization and detection were carried out in accordance to the instructions in the DIG Application Manual for Filter Hybridization (2008 by Roche Diagnostics GmbH). All labeling, hybridization and detection reagents were purchased from Sigma-Aldrich (St. Louis, MO). Hybridization was carried out at 42 °C overnight. The chemiluminescent substrate CDP-Star-ready-to-use was used for detection, according to manufacturer’s instructions (Roche Diagnostics GmbH). The signal was detected by exposing the hybridized blot to X-ray film.

TRF analysis was performed as previously described^{65 (link)}. In brief, genomic DNA was isolated by phenol–chloroform extraction and digested with AluI and MboI overnight. A total of 4 µg of digested gDNA was separated on 0.7% agarose gel at 40 V and transferred to a positively charged Nylon membrane (Amersham, RPN203B). After cross-linking the DNA and prehybridization (5× SSC. 0.1% N-lauroylsarcosine sodium salt solution, 0.04% SDS) for 2 h at 65 °C, the membrane was incubated with digoxigenin-labelled TelG probe diluted in hybridization buffer (1.3 nM final concentration) overnight at 65 °C. Digoxigenin-labelled TelG probe was generated as previously described^{66 (link)}. Then, the membrane was washed three times with wash buffer 1 (2× SSC, 0.1% SDS), one time with wash buffer 2 (2× SSC) for 15 min each and blocked in freshly prepared blocking solution (100 mM maleic acid, 150 mM NaCl, pH 7.5, 1% (w/v) blocking reagent (Roche, 11096176001)) for 30 min. Next, the membrane was incubated for 30 min in anti-digoxigenin-AP antibodies (Roche, 11093274910) diluted in blocking solution, washed twice in wash buffer 3 (100 mM maleic acid, 150 mM NaCl, pH 7.5, 0.3% (v/v) Tween-20) for 15 min each and equilibrated in AP buffer (100 mM Tris, 100 mM NaCl, pH 9.5) for 2 min. Digoxigenin-labelled telomeric DNA was detected using CDP-star ready to use (Roche, 12041677001) solution.

Genomic DNA was isolated using Illustra DNA Extraction kit Phytopure (GE Healthcare, Buckinghamshire, UK). About 10 μg DNA was digested with EcoRV and separated on a 1% agarose gel and blotted to a Hybond N+ membrane (GE Healthcare). A 498 bp npt II PCR product amplified with primers 5′‐ CCTGTCATCTCACCTTGCTC ‐3′ and 5′‐AGTCCCGCTCAGAAGAACTC ‐3′ and labelled with PCR DIG Probe synthesis kit (Roche Diagnostics GmbH, Mannheim, Germany) was used as probe and hybridized to the membrane o/n. CDP‐Star, ready‐to‐use (Roche Diagnostics GmbH, Mannheim, Germany) was used for detection of the hybridized probe and exposed to an X‐ray film.