Pcr master mix

DNA was extracted by DynaBio Blood/Tissue Genomic DNA extraction kit (TAKAPUZIST®) according to manual. The quantity and quality of extracted product was tested via spectrophotometer at 260 and 280 nm and electrophoresis on 1% agarose gel. The PvAMA-1 gene, including domain I, domain II and domain III, expressing amino acids (AA) from 42–488 was aimed for amplification. The primers were selected based on the sequence of P. vivax Sal-1 PvAMA-1gene (ACCESSION NO.: XM_001615397). The amplification for PCR was performed in a 200 µl PCR tube containing: 200 ng (2 µl) extracted DNA as template, 25 pmol(1 µl) of each primer, 7.5 µl of PCR master mix (Roche) and ddH2O up to 15 µl. The targeted gene was amplified for 30 cycles as follows: initial denaturation at 95°C for 5 min followed by 30 cycles with denaturation at 94 °C for for 20s, annealing at 58◦C for 30s and extension at 72 °C for 2 min and final extension at 72 °C for 5 min), PCR product was 1330 bp (Figure 1) which contained domain I, domain II and domain III of the PvAMA-1 gene with PvAMA F (5′ CCATGGGGCCTACCGTTGAGAGAA-3′) and PvAMA R as (5′CTCGAGTCATAGTAGCATCTGCTTGTT-3′) primers (24 (link)). The product was analyzed on 1% agarose gel against size marker (Fermentase®).

After serological tests were completed, 260 seronegative cattle were selected for the detection of PI animals. Ear notch biopsies were collected and frozen at − 80 °C until used. About 1 cm3 of tissue was then fragmented in 1 mL of sterile PBS and centrifuged at 13.000×g for 5 min. RNA was extracted from the supernatant using a RNeasy Mini Kit (QIAGEN®, Germany) and stored at − 80 °C until used. Two steps RT-PCR was performed for the detection of the virus, in which the retrotranscription step was carried out with random primers, (Invitrogen® USA), MLV-RT (Invitrogen®, USA), dNTPs (Invitrogen®, USA) and RNA out (Invitrogen®, USA). After this, it was used the cDNA for the PCR using primers previously described [35 (link)] directed to the 5’UTR of the virus with an expected product of 288 bp with a PCR master mix (Roche ®). The sensitivity of the PCR was tested by cloning the PCR product on a pELMO vector (See section below) [36 ]. The results were observed on 1.5% agarose gels prepared in 1× TAE (Biorad®, USA) and dyed with 1× HydraGreen fluorescent inter-calating dye (ACTGene, USA). DNA extracted from a blood sample of an infected animal was used as positive control for BVDV and RNase- and DNase-free water as negative amplification control.

At day 1 post MCAO, total mRNA was extracted from the ischemic hemisphere brain tissue using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manual instructions. After determination of the concentration of mRNA, mRNA (1 μg) was reversed transcribed into cDNA using PrimeScript^TM RT reagent Kit (TaKaRa, Shiga, Japan). Amplification of gene sequence using SYBR gene polymerase chain reaction (PCR) Master Mix (Roche, Indianapolis, IN, USA) was performed on the Opticon 2 Real-Time PCR Detection System (Bio-Rad). The primers used in our study are listed as follows: TNF-α forward: TATGGCTCAGGGTCCAACTC, TNF-α reverse: GGAAAGCCCATTTGAGTCCT; IL-6 forward: GCTGGTGACAACCACGGCCT, IL-6 reverse: AGCCTCCGACTTGTGAAGTGGT; IL-1β forward: TGCCACCTTTTGACAGTGATG, IL-1β reverse: TGATGTGCTGCTGCGAGATT; iNOS forward: TCCTGGACACGACCCCT, iNOS reverse: CTCTGACTGACACAAGG; IL-10 forward: AAATAAGAGCAAGGCAGTGG, IL-10 reverse: GTCCAGCAGACTAAATACACAC;β-actin forward: CACCCGCGAGTACAACCTTC, β-actin reverse: CCCATACCCACCATCACACC; β-actin served as a reference gene.

Total RNA used for cDNA preparation was extracted from mouse tissues using the RNeasy kit (Qiagen). Total RNA from human tissues was purchased from Clontech (Cat No: 636643). Polyadenylated mRNA was isolated using the Oligotex mRNA mini kit (Qiagen). cDNA was prepared using the Reverse Transcriptase PCR kit (Fermentas) according to manufacturers recommendation with the exception of: Odt and random hexamer primers were added at equal concentration and the reaction mixture was incubated for 60 min and immediately used for subsequent RT-PCR or RACE-PCR. UBE1 was used as positive control. PCR was performed in 20 μL reactions composed of 0.8 μL of a 10 μM dilution of the forward primer and reverse primer, 10 μL of PCR Master Mix (Roche −11636103001). See Additional File 16 for the PCR conditions and primer sequences.

For the mouse small intestinal tissue samples and human CRC samples obtained in the United Kingdom (Wales cohorts 1 and 2), total RNA was used to synthesize first strand cDNA using a VersoTM cDNA Kit (Thermo Scientific) and anchored oligo-dT primers (Thermo Scientific) according to the manufacturer’s instructions. Single-stranded cDNA samples were amplified in a Polymerase chain reaction (PCR) using sequence-specific primers (Eurogentec) and probes from the Universal Probe Library (Roche) that were designed using the Universal ProbeLibrary Assay Design Centre, using PCR Master mix (Roche) and a light cycler 480 (Roche) (see Supplementary Table 2 for primers and probes used).
For the human CRC samples recruited in Brazil, RNA was extracted using the RNeasy^® Mini Kit (Qiagen, Hilden, Germany). cDNA was produced using TaqMan^® Reverse Transcription Reagents kit (Applied Biosystems, Carlsbad, CA, United States) according to the manufacturer’s protocol. Quantitative PCR reactions were performed using the 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, United States) (see Supplementary Table 3 for expression assay specifications).

At day 1 after MCAO, total mRNA was extracted from the ischemic hemisphere brain tissue using a Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manual instructions. One microgram of mRNA was reverse transcribed into cDNA using a PrimeScript^TM RT reagent Kit (TaKaRa, Shiga, Japan). An SYBR gene polymerase chain reaction (PCR) Master Mix (Roche, Indianapolis, IN, USA) was used to amplify the targeted gene sequence on the Opticon 2 Real-Time PCR Detection System (Bio-Rad). The primers used in our study are listed as follows: IL-1β forward: TGCCACCTTTTGACAGTGATG, IL-1β reverse: TGATGTGCTGCTGCGAGATT; IL-6 forward: GCTGGTGACAACCACGGCCT, IL-6 reverse: AGCCTCCGACTTGTGAAGTGGT; TNF-α forward: TATGGCTCAGGGTCCAACTC, TNF-α reverse: GGAAAGCCCATTTGAGTCCT; IL-10 forward: AAATAAGAGCAAGGCAGTGG, IL-10 reverse: GTCCAGCAGACTAAATACACAC; TGF-β forward: TGCGCTTGCAGAGATTAAAA, TGF-β reverse: CGTCAAAAGACAGCCACTCA; CCL2 forward: CTGCTGTTCACAGTTGCCG, CCL2 reverse: GCACAGACCTCTCTCTTGAGC; β-actin forward: CACCCGCGAGTACAACCTTC, β-actin reverse: CCCATACCCACCATCACACC; β-actin served as a reference gene.

Total RNA was isolated from the indicated cells using TRIzol (Invitrogen, Grand Island, NY, USA), according to the manufacturer’s instructions. The cDNA was synthesized using the Transcriptor First Strand cDNA Synthesis kit (Tiangen, Beijing, China). Real-time PCR was prepared using a PCR Master Mix (Roche, Basel Schweiz, Switzerland) according to the manufacturer’s protocol. It was then performed on an iCycler (Bio-Rad Laboratories, Hercules, CA, USA). The primer sequences are shown in sTable 3. The PCR conditions were 94 °C for 12 s, 60/58 °C for 12 s, and 72 °C for 12 s. The quantification was based on ∆∆CT calculations and was normalized to GAPDH.