This study was approved by the Animal Subjects Committee, University of Tsukuba, Japan (approval number: 18‐425). B6;129S1‐Rnlstm1Gvd/J mice were purchased from Jackson Laboratory. Homozygotes were produced by mating heterozygous mice. Renalase KO and wild‐type (WT) mice were identified by PCR using genomic DNA obtained from the tail (WT, 499‐bp product, WT forward primer F, 5'‐AAATCCCCAGTTACTTATGGCTCC‐3', and WT reverse primer 5'‐GAGACAGTGACAGAGAGAAACCAGC‐3'; KO, 292‐bp product, KO forward primer 5'‐AGGCTATTCGGCTATGACTGGG‐3', and KO reverse primer 5'‐TGGATACTTTCTCGGCAGGAGC‐3'; Wu et al., 2011 ). A total of 11 male mice were provided standard chow and water ad libitum, and housed under standard laboratory conditions (20°C–26°C, 12:12‐hr light–dark cycle). At 7 weeks of age (7 weeks old; KO, n = 6, body weight = 20–26 g; WT, n = 5, body weight = 19–23 g), we cut the right sciatic nerve of all mice under anesthesia. We conducted a sham operation on the left leg of all mice under anesthesia. The animals were killed 1 week after the operation.
B6 129s1 rnlstm1gvd j mice
Manufactured by Jackson ImmunoResearch
The B6;129S1‐Rnlstm1Gvd/J mouse strain is a genetically engineered mouse model. This strain carries a targeted mutation in the Rnls gene, which plays a role in regulating renal function. The specific details and applications of this mouse model are not provided in order to maintain an unbiased and factual approach.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using b6 129s1 rnlstm1gvd j mice
1
Sciatic Nerve Injury Model in Mice
2
Hepatic Lipid Metabolism in Renalase KO Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
B6;129S1-Rnlstm1Gvd/J mice were purchased from the Jackson Laboratory. Renalase KO and wild type (WT) mice were produced by mating heterozygous mice and identified by polymerase chain reaction (PCR) amplification of mouse genomic DNA, as previous described (7 (link)). A total of 24 male mice (KO, n=12; WT, n=12) were fed standard chow and water ad libitum and housed under standard laboratory conditions (23.5±2.5°C, 52.5±12.5%, 14:10-h light-dark cycle). At 6 weeks of age, these mice were divided into four groups; WT-normal diet (ND; MF 12 mm φ pellet; Oriental Yeast Co.), WT-choline-deficient, L-amino acid-defined, high-fat diet (CDAHFD; A06071302, Research Diets), KO-ND, and KO-CDAHFD. The diet was replenished every 3–4 days. After 6 weeks under each condition, the mice were killed by cervical dislocation after anesthesia with 5 ml of the mix solution (isoflurane:propylene glycol=3:7) added to the container of approximately 3L. The current study followed the ethical guidelines from western institutions to justify the method of euthanasia used in the study. In addition, the volume of propylene glycol used in the current study exhibited no toxicity (18 (link)). Liver samples and blood from the inferior vena cava were collected. The sera were collected by centrifugation (4°C, 3,000 × g, 30 min) after settling for 16 h at 4°C. Samples were stored at −80°C for subsequent analyses.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!