Total RNA was isolated from mast cells by using RNAiso Plus reagent (Takara) and NucleoSpin RNAXS (Takara). The cDNA was synthesized using SuperScript VILO cDNA synthesis kit (Life Technologies), and semiquantitative PCR was then performed using TAKARA Ex Taq HS DNA polymerase (Takara). The level of HDC, MCP5, CPA, Axin2, and Tcf7 mRNA was quantified using the SYBR Green detection system (Applied Biosystems). Results were normalized by expression of the GAPDH transcripts. The sequences of the primers used in this study are listed in Tables 1 and 2 .
Takara ex taq hs dna polymerase
Manufactured by Takara Bio
Sourced in Japan
TaKaRa Ex Taq HS DNA polymerase is a high-sensitivity DNA polymerase designed for PCR amplification. It exhibits robust performance and high fidelity.
Automatically generated - may contain errors
Lab products found in correlation
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Dna isolation kit, by Qiagen (2 mentions)
Cleanseq system, by Beckman Coulter (2 mentions)
Nucleospin rna xs, by Takara Bio (1 mentions)
Sybr green detection system, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Takara taq dna polymerase, by Takara Bio (1 mentions)
T7 endonuclease 1, by New England Biolabs (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Veriti 96 well thermal cycler, by Thermo Fisher Scientific (1 mentions)
Ex taq buffer mg2 plus, by Takara Bio (1 mentions)
Bigdye terminator v3.1 cycler sequencing kit, by Thermo Fisher Scientific (1 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Abi steponeplus system, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Isogen, by Nippon Gene (1 mentions)
10 protocols using takara ex taq hs dna polymerase
1
Quantitative Analysis of Gene Expression in Mast Cells
2
CRISPR/Cas9-Mediated Gene Editing in DF-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The aliquots of DF-1 cells transfected with CRISPR/Cas9 vectors were collected (as described in Section 2.2 ), subcultured, and harvested for genomic DNA extraction. The targeted regions of tva, tvc, and tvj genes were amplified using the primers TVA-fw and TVA-rv for tva, TVC-fw and TVC-rv for tvc, and TVJ-fw and TVJ-rv for tvj (primer sequences listed in Table 1 ). The cycling conditions were as follows: 98 °C for 3 min, 40 cycles of 10 s at 98 °C, 30 s annealing, and 30 s amplification at 72 °C. The final amplification was held for 5 min. The annealing temperatures were 65 °C for tva and tvj and 61 °C for tvc. TaKaRa Taq DNA polymerase (TaKaRa, Kusacu, Japan) was used for for tva and tvc amplification while TaKaRa Ex Taq HS DNA polymerase was used for tvj amplification. The T7E1 assay was used to determine indel efficiency. Briefly, 200 ng of the resulting PCR products were denatured in 19 μL 1× NEB buffer 2 for 5 min at 95 °C, quickly chilled to 85 °C (−2 °C/s) and reannealed by slowly decreasing the temperature (−0.1 °C/s) from 85 °C to 25 °C. Then, 10 U of T7 Endonuclease I (New England Biolabs, Ipswich, MA, USA) were added for 20 min at 37 °C. Cleavage of heteroduplex amplicons was then analyzed by agarose electrophoresis.
3
IFN-γ +874 T/A Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The IFN-γ +874 T/A (rs2430561) genotype was determined using the allele-specific PCR method. Genomic DNA was extracted from whole blood using a DNA Isolation kit (Qiagen). The reaction volume was 20 μL, comprising 1 μL of genomic DNA, 0.2 mM of dNTPs, 0.5 U of TaKaRa Ex Taq HS DNA polymerase (TaKaRa Bio, Japan), and 0.5 μM of each of 3 primers: 5'-TCA ACA AAG CTG ATA CTC CA-3' (common reverse), 5'-TTC TTA CAA CAC AAA ATC AAA TCT -3' (T allele specific forward), and 5'-TTC TTA CAA CAC AAA ATC AAA TCA-3' (A allele specific forward) [15 (link)]. The amplified product was analysed by electrophoresis on a 2% agarose gel.
4
Genotyping of Cytokine Gene Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The IL-4 -590C/T (rs2243250), IL-4Rα Q576R (rs1801275), and IFN-γR -611G/A (rs1327474) genotypes were determined using the polymerase chain reaction restriction fragment length polymorphism method. Genomic DNA was extracted from whole blood using a DNA Isolation kit (Qiagen GmbH, Hilden, Germany). The reaction volume was 20 μL, comprising 1 μL of genomic DNA, 0.2 mM of dNTPs, 0.5 U of TaKaRa Ex Taq HS DNA polymerase (TaKaRa Bio, Japan), and 0.5 μM of each of 2 primers. We used the primers 5'- ACTAGGCCTCACCTGATACG -3' (forward) and 5'- GTTGTAATGCAGTCCTCCTG -3' (reverse) [12 (link)] for analysis of IL-4 -590C/T, the primers 5'- GCCCCCACCAGTGGCTACC -3' (forward) and 5'- GAGGTCTTGGAAAGGCTTATAC -3' (reverse) [13 (link)] for analysis of IL-4Rα Q576R, the primers 5'- CTCTTCATGAGAGGCTGTCT -3' (forward) and 5'- TAACTCTTGGAGTTCACCTGG -3' (reverse) [14 (link)] for analysis of IFN-γR -611G/A. Identification of the alleles at each polymorphic site was performed by incubating the PCR product with the restriction enzyme BsmFI (IL-4), MspI (IL-4Rα), and Hpy188I (IFN-γR) (New England Biolabs, Ipswich, MA, USA) followed by electrophoresis through a 2.0% agarose gel (for IL-4) or a 6% polyacrylamide gel (for IL-4Rα and IFN-γR).
5
ACTN4 Overexpression in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ACTN4 cDNA was amplified by PCR using TaKaRa Ex Taq HS DNA polymerase (TaKaRa Bio Inc., Kyoto, Japan) and the primers: ACCATGGACTACAAGGACGACGATGACAAGATGGTGGACTACCACGCGG and TCATCTATCTAGATCTTCACAGGTCGCTCTCGCCATAC. The PCR product was cloned into the pcDNA 3.1/V5-His TOPO TA vector (Life Technologies). A549 cells plated at a density of 3 × 105 cells in six-well plates were transfected with 2.5 μg of the ACTN4-pcDNA construct or control plasmid using Lipofectamine 2000 (Life Technologies) in accordance with the manufacturer's protocol.
6
Nested PCR for KRAS QC Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nested PCR was used to prepare a QC plasmid to evaluate real-time PCR targeting of the KRAS gene. The PCR reaction mixture (20 μl) contained 1X Ex Taq Buffer (Mg2+ plus; TaKaRa), 250 μM of each dNTP (TaKaRa), 0.5 units of TaKaRa Ex Taq HS DNA Polymerase (TaKaRa), 200 nM each of SW-131 and SW-132, 50 ng of human homozygous wide-type gDNA (WT-gDNA). Reactions were performed on Veriti™ 96-well Thermal Cyclers (Applied Biosystems, Forster City, CA, USA) using the following cycling conditions: denaturation at 94°C for 5 min; 35 cycles at 94°C for 30sec, 60°C for 30 sec and 72°C for 30 sec; and a final extension step at 72°C for 5 min. The PCR products were diluted 50-fold and used in a second round of PCR. The second round of PCR contained the same reagents apart from the template and primers i.e. 200 nM each of universal forward (SW-145) and mutant-allele specific revers primers (SW-428 and SW439) (Table 1 ). The PCR products were sequenced using the BigDye Terminator V3.1 Cycler Sequencing Kit (Applied Biosystems). After the genotype of the amplicons was confirmed, the PCR products were cloned to construct the wild-type QC (WT-QC) and mutant QC (MT-QC) plasmids.
7
Quantifying NT5E Allelic Imbalance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify the potential allelic imbalance of NT5E transcripts, we designed PCR primers to c.1475 T > A in exon 8 of NT5E. The forward primer was 5′- gggacagggtggtcaagtta −3′, and the reverse primer was 5′- cagagtcatgttttatcttttcatctt −3′. A total of 14 skeletal muscles from heterozygotes in Japanese Black cattle in NLBC were collected. We used 50 ng of template cDNA from skeletal muscles or 10 ng of genomic DNA from heterozygous animals for PCR amplification with TaKaRa Ex Taq HS DNA Polymerase (TaKaRa, Cat. #RR006). The PCR product was directly sequenced and purified using the CleanSEQ system (Agencourt, Cat. #A29154). The peak heights at the polymorphic sites were quantified using PeakPicker 2 software [17 (link)]. Allelic imbalances were estimated as the ratio of the peak height of the Q allele to that of the q allele in cDNA and in genomic DNA from the same animal. Calibration curves were generated using data obtained by mixing varying amounts of genomic DNA from Q and q homozygotes. Welch’s t-test was performed to compare the differences between the ratios of the peak height of the Q allele over the q allele in genomic DNA and cDNA.
8
Quantifying ACVR2A Allelic Imbalance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify the allelic imbalance of ACVR2A transcripts, we designed PCR primers to BovineHD4100001198 (48,443,632 bp) on BTA2, located in an intron of ACVR2A. The forward primer was 5′-aacctagaaaccgtagaaagacga-3′, and the reverse primer was 5′-gatggcatctcttggctcat-3′. We used 50 ng of template cDNA from primary bovine dermal fibroblasts or bovine brain tissues (medulla oblongata), or 10 ng of gDNA from heterozygous animals for PCR amplification with TaKaRa Ex Taq HS DNA Polymerase (TaKaRa, Cat. #RR006). The PCR product was directly sequenced and purified with the CleanSEQ system (Agencourt, Cat. #A29154). Peak heights at polymorphic sites were quantified using PeakPicker 2 software [30 ]. Allelic imbalances were estimated as the ratio of the peak height of the Q allele to that of the q allele in cDNA and in gDNA. Calibration curves were generated using data obtained by mixing varying amounts of gDNA from Q and q homozygotes.
9
PACRG Mutation Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Captured cells were centrifuged at 15 000g for 10 min. DNA was extracted and amplified with a Picoplex Whole Genome Amplification kit (Rubicon) according to the manufacturer's instructions. Products of DNA amplification were checked on an agarose gel 1.5%, purified using the High Pure PCR Kit (Roche) and quantified using Qubit fluorometer (Life Technologies). Sanger sequencing assays to detect 18 somatic mutations were tested on the amplified DNA, but due to technical inefficiencies, only the assay to detect a G340A mutation in PACRG proving fit for purpose. In brief, a portion of the PACRG gene containing the mutated locus was amplified using primers PACRG-F1 (5′-GCCCGAATGCTGTTTTCACA) and PACRG-R1 (5′-GGTTGTCTGGCCTCCTAAGT) with PCR cycling conditions of 98°C for 20 s, 59°C for 30 s, 72°C for 30 s for 33 cycles using TaKaRa Ex Taq HS DNA Polymerase (TaKaRa Bio). The resulting PCR product was then purified using QIAquick PCR Purification Kit (Qiagen) and directly sequenced.
10
Semi-Quantitative and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using ISOGEN (Nippon Gene, Tokyo, Japan) or RNAiso Plus (TaKaRa, Shiga, Japan). cDNA was synthesized using a SuperScript VILO cDNA synthesis kit (Life Technologies), and semi-quantitative PCR was then performed using TaKaRa ExTaq HS DNA polymerase (Takara). Semi-quantitative PCR reactions were performed by heating to 94°C for 2 min, and then the samples were subjected to number of cycles of 94°C for 15 sec, 55°C for 30 sec with 72°C for 30 sec and a final extension of 72°C for 1 min. In the case of C6 cell-derived cDNA, 3% dimethyl sulfoxide was added. The product was analyzed by 2% agarose/TBE gel electrophoresis followed by staining with ethidium bromide. Quantitative real-time RT-PCR was performed with Fast SYBR Green Master Mix using an ABI StepOne Plus system (Life Technologies). Relative quantification was performed against a standard curve and the values were normalized against the input determined for the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The sequences of the primers used in this study are listed in Tables 1 and 2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!