Dig labeled utp

Manufactured by Roche

DIG-labeled UTP is a laboratory reagent used in molecular biology applications. It is an uridine triphosphate (UTP) molecule that has been labeled with a digoxigenin (DIG) moiety. DIG-labeled UTP can be incorporated into nucleic acid strands during in vitro transcription or labeling reactions.

Automatically generated - may contain errors

Lab products found in correlation

Rna cleanup kit, by Qiagen (2 mentions) Rna polymyerase t7 or sp6, by New England Biolabs (1 mentions) Mirvana mirna probe construction kit, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions) Competent e coli dh5α, by Thermo Fisher Scientific (1 mentions) Custom designed primers to conserved mirnas, by Qiagen (1 mentions) Monarch gel purification kit, by New England Biolabs (1 mentions) T7 or sp6 rna polymerase, by New England Biolabs (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Lightcycler 480 sybr green 1 master, by Roche (1 mentions) Miscript 2 rt kit, by Qiagen (1 mentions) Pgem t easy, by Promega (1 mentions)

Close spelling variants of this product

DIG)-labeled 11-UTP DIG-UTP

3 protocols using dig labeled utp

Axolotl JunB, Vimentin, NG2, and Galectin-1 ISH Probes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Axolotl specific JunB probes were created by PCR amplification with the addition of the T7 and Sp6 promoter into the PCR primers:
T7 JunB ISH For 5′-AGAtaatacgactcactatagggAATGTGCCGTGCAGCGGATA-3′
Sp6 JunB ISH Rev 5′-AGAtatttaggtgacactatagAAGAGGTAGAGGGAGCCCAGTC-3′
The resulting PCR product was used to synthesize in situ probe by the addition of DIG-labeled UTP (Roche) plus the appropriate RNA Polymyerase T7 or Sp6 (NEB). Probes were purified with RNA Clean Up kit (Qiagen) and resuspended in 100 μL of hybridization buffer.
Primers for other genes (5′–3′):
Vimentin ISH Forward ACAAGTCAAAGTTCGCTGAT
Vimentin ISH Reverse CCATCTCTGGTCTCAACAGT
NG2 ISH Forward CTTACTGTCGACGAGGAGAC
NG2 ISH Reverse TCGGGCTGTTGTACTATCTT
Galectin-1 Forward TAGGGGTCATGTGACTTTTC
Galectin-1 Reverse AGGCAACTAGTCCAGTTTGA
The PCR fragment was subcloned into pGemTEasy vector. The plasmid was then linearized and used to synthesize in situ probe by the addition of DIG-labeled UTP (Roche) plus the appropriate RNA Polymyerase T7 or Sp6 (NEB). Probes were purified with RNA Clean Up kit (Qiagen) and resuspended in 100 μL of hybridization buffer.

Sabin K.Z., Jiang P., Gearhart M.D., Stewart R, & Echeverri K. (2019). AP-1cFos/JunB/miR-200a regulate the pro-regenerative glial cell response during axolotl spinal cord regeneration. Communications Biology, 2, 91.

+ Open protocol

+ Expand

Small RNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent (Invitrogen), and small RNA fractions (≤ 200 nt) were purified from total RNA using a mirVana miRNA isolation kit (Ambion). RNA blot for miRNAs detection was carried out with DIG-labeled RNA probes, which generated by in vitro transcription using a mirVana™ miRNA probe construction kit (Ambion) with DIG-labeled UTP (Roche). For details see S1 Methods.

Chen H., Arsovski A.A., Yu K, & Wang A. (2016). Genome-Wide Investigation Using sRNA-Seq, Degradome-Seq and Transcriptome-Seq Reveals Regulatory Networks of microRNAs and Their Target Genes in Soybean during Soybean mosaic virus Infection. PLoS ONE, 11(3), e0150582.

+ Open protocol

+ Expand

Axolotl Spinal Cord Injury RNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Injured spinal cords 500μm rostral and 300μm caudal to the lesion from 7-10 control or miR-200a inhibitor electroporated animals were micro dissected and pooled for each biological replicate. Total RNA was isolated using Trizol (Invitrogen) according to the manufacturer's instructions. Subsequent cDNA was synthesized from 1μg of DNaseI (NEB) treated RNA using either High Capacity cDNA Reverse Transcription kit (Applied Biosystems) or miScript II RT kit (Qiagen). The qRT-PCR was carried out using Light Cycler 480 SYBR Green I Master (Roche). MicroRNA qRT-PCR was carried out with custom designed primers to conserved miRNAs (Qiagen) and custom primers from IDT were used to quantify axolotl mRNAs: The resulting PCR fragments were gel purified using the Monarch Gel Purification Kit (New England Biolabs) and TA cloned into pGEM-T Easy (Promega) then transformed into DH5α competent E. coli (Invitrogen). Blue/White positive selection was used to pick clones and recovered plasmids were sent for sequencing. Positive clones were digested with the appropriate enzyme to linearize the plasmid and anti-sense ribonucleoprobe synthesis was carried out using Sp6 or T7 RNA polymerase (New England Biolabs)+DIG labeled UTP (Roche). Subsequent probes were cleaned up using the RNA Clean Up kit (Qiagen) and resuspended in hybridization buffer.

Walker S.E., Sabin K.Z., Gearhart M.D., Yamamoto K., & Echeverri K. (2021). Regulation of stem cell identity by miR-200a during spinal cord regeneration.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!