Kapa hifi hotstart readymix dna polymerase

DNA from bile juice was extracted using a QIAamp PowerFecal DNA Kit (Qiagen, Valencia, CA). The quality and quantity of DNA were measured using the Qubit 3 system (Invitrogen, Carlsbad, CA). The bacterial 16S rRNA gene was amplified with Pro341F/Pro805R (V3–V4) primers [33 (link)] designed with Nextera overhang adapters (Illumina, San Diego, CA) using KAPA HiFi HotStart ReadyMix DNA polymerase (Roche Diagnostics Ltd., Burgess Hill, UK) to construct amplicon libraries. A second PCR step was performed to attach dual indices and Illumina sequencing adapters with Nextera XT index primers (Integrated DNA Technologies, Coralville, IA) using KAPA HiFi HotStart ReadyMix DNA polymerase (Roche Diagnostics). The resultant amplicons were purified using AMPure XP beads (Beckman Coulter, Brea, CA). After PCR products were quantified, equimolar ratios from each sample were pooled and sequenced on a MiSeq System (Illumina) according to the manufacturer’s instructions. It showed no amplification that the negative control using PBS buffer apply to similarly steps for DNA extraction and several PCR.

Because of low coverage, we enriched the shotgun library of sample BRO001 and RIJ001 for HSV-1 DNA using an Arbor Biosciences Custom MyBaits multispecies viral capture kit (v4), which includes sequences from 283 HSV-1 genome sequences and 261 HSV-2 genome sequences. The captured library was amplified using 2× KAPA HiFi HotStart ReadyMix DNA Polymerase as detailed in (51 (link)) and sequenced on a NextSeq500 platform (150 bp, paired-end) at the Estonian Biocentre.

Primers were designed using Oligo7 and Primer3 softwares for exome sequencing variants that were considered potentially relevant to the lymphedema phenotype. Polymerase chain reactions (PCRs) were performed using the Kapa HiFi HotStart ReadyMix DNA Polymerase (KapaBiosystems #KK2602) as per manufacturer's instructions. To visualize DNA fragments, 5 µL of the PCR product was loaded on a 1% agarose gel (or Lonza 1.2% agarose Flash Gel); ethidium bromide was used for staining. Purification of the DNA was done utilizing Qiagen Gel Extraction Kit (#28706) following manufacturer's instructions. Purified PCR products were sequenced at the University of Texas MD Anderson Cancer Center Genetic Core Facility using a 3730XL DNAnalyzer (AppliedBiosystems, Foster City, California, USA). Mutation INPPL1 (O15357) p.T180A was validated using primers 5′ GAGGCCTTCTAAGACCCCAC 3′ and 5′ GGTGTAATACATGGGGCTGG 3′. Mutation HGF (P14210) p.G315V was validated using primers 5′ TGATCAGAAATCCACCTAGGGAT 3′ and 5′ ACATGTGGAGGTAAAATGCATTTAA 3′.