4d nucleofecter

Primary T cells were stimulated with Dynabeads Human T Activator anti-CD3/28 (Thermo Scientific). Four days after the stimulation, electroporation was performed using an Amaxa P3 Primary Cell Kit and 4D-Nucleofecter (Lonza). Ten micrograms of recombinant S. pyogenes Cas9 (Thermo Fisher Scientific) and 1.25 μg of chemically synthesized sgRNAs for DGKa and DGKz were incubated for 20 min before electroporation to generate Cas9-gRNA RNP complexes. A total of 5 × 10⁵ cells were resuspended, and P3 buffer was added to the pre-incubated Cas9-gRNA RNP complexes. Cells were nucleofected using the program EO-115. One week after the electroporation, the cells were collected and the genomic DNA was isolated. The frequency of indels was calculated by Tracking of Indels by Decomposition (TIDE) analysis.

CRISPR/Cas9-mediated genome editing of T cells was carried out as follows. Human peripheral blood pan-T cells were purchased from STEMCELL Technologies. Upon thawing, the T cells were allowed to rest overnight in RPMI supplemented with FBS, hrIL-2 (Peprotech, 50 U/mL), and hrIL-7 (Peprotech, 5 ng/mL) prior to activation. Activation was induced by the addition of Dynabeads Human T Activator anti-CD3/28 (ThermoFisher SCIENTIFIC) at a bead-to-cell ratio of 3:1 in RPMI supplemented with 10% FBS. 3 days later, the activating beads were removed and electroporation was carried out using an Amaxa P3 Primary Cell kit and 4D-Nucleofecter (Lonza). Eight micrograms of recombinant S. pyogenes Cas9 (Toolgen) and 2 μg of 5′-OH sgRNA were incubated for 20 min prior to electroporation to generate Cas9-gRNA RNP complexes. A total of 5 × 10⁵ stimulated T cells re-suspended in P3 buffer were added to the pre-incubated Cas9-gRNA RNP complexes. Cells were nucleofected using program EO-115. Following electroporation, cells were seeded at 5 × 10⁵ cells per mL in RPMI supplemented with 10% FBS, hIL-2 (Peprotech, 50 U/mL), and hIL-7 (Peprotech, 5 ng/mL). Electroporation-only controls were nucleofected without RNP complexes using the same conditions. Cells were counted using Countess II Fl (Life technologies). Images of the cells were taken using an EVOS Fl Cell Imaging System (Thermo Fisher Scientific).

Cas9 RNP mediated editing of CAR T cells was carried out on day 3 of culture (one day after retroviral transduction) according to previously published methods^{55 (link)}. Two IFNAR1 targeting crRNAs (Mm.Cas9.IFNAR1.1.AA (TCAGTTACACCATACGAATC) and Mm.Cas9.IFNAR1.1.AB (GCTTCTAAACGTACTTCTGG)) and Alt-R CRISPR-Cas9 Negative Control crRNAs #1 and #2 were ordered from Integrated DNA Technologies (IDT). Alt-R crRNA and Alt-R tracrRNA duplexes were prepared at equimolar concentrations and annealed at 95 °C for 5 min. 150 pmol of each duplex was precomplexed with 120 pmol TrueCut Cas9 Protein v2 (Thermo Fisher Scientific) for 10–20 min to modify 1 × 10⁷ cells. T cells were mixed with RNP complex and Cas9 Electroporation Enhancer (4 uM, IDT). Nucleofection was performed using the Amaxa P4 Primary Cell kit and 4D-Nucleofecter (Lonza) using the program CM137.