The gene expression of types I, II and X collagen, aggrecan and Sox9 was analyzed by RT-qPCR detection. Total RNA was sequentially extracted with an additional purification step employing an RNA isolation kit [Tiangen Biotech (Beijing) Co., Ltd., Beijing, China] according to the manufacturer’s instructions. An equal quantity of RNA (300 ng) was used as a template and reverse transcribed into cDNA using an RT kit (Fermentas, Burlington, ON, Canada), and then amplified using a SYBR Green Realtime PCR Master Mix kit (Roche Diagnostics, Mannheim, Germany) on a real-time fluorescence quantitative instrument (RealPlex 4; Eppendorf Corporation, New York, NY, USA). The primers (from Parkson Company, Shanghai, China) used for PCR are shown in (Table I ). The dissociation curve of each primer pair was analyzed to confirm the primer specificity. Marker gene expression levels of the chondrocytes were analyzed by the 2−ΔΔCT method using GAPDH as the internal control. Each sample was repeated three times for each gene.
Sybr green realtime pcr master mix kit
Manufactured by Roche
Sourced in United States
The SYBR Green Realtime PCR Master Mix kit is a laboratory reagent used for real-time quantitative polymerase chain reaction (qPCR) analysis. The kit contains all the necessary components, including SYBR Green I dye, required for the amplification and detection of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Rna isolation kit, by Tiangen Biotech (2 mentions)
Realplex4, by Eppendorf (2 mentions)
Quantstudio 6 flex system, by Thermo Fisher Scientific (2 mentions)
Cfx manager software, by Bio-Rad (2 mentions)
Rneasy plant mini kit, by Yeasen (2 mentions)
Gdna remover, by Yeasen (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Abi 7900 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Amv reverse transcriptase, by Promega (1 mentions)
Rever tra ace qpcr rt master mix, by Yeasen (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Random primer, by New England Biolabs (1 mentions)
M mulv reverse transcriptase, by New England Biolabs (1 mentions)
8 protocols using sybr green realtime pcr master mix kit
1
Quantifying Chondrocyte Gene Expression
2
Quantifying Gene Expression in U118 and U138 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from U118 and U138 cells was isolated using an RNA isolation kit [Tiangen Biotech (Beijing) Co., Ltd., Beijing, China] according to the manufacturer's instructions. Equal quantities of RNA (300 ng) were used to reverse transcribe the cDNA using an RT kit (Fermentas, Burlington, ON, Canada). Amplification of the cDNA was performed using a SYBR Green Realtime PCR Master Mix kit (Roche Diagnostics, Mannheim, Germany) on a real time fluorescence quantitative instrument (RealPlex 4; Eppendorf Corporation, New York, NY, USA). All primers used were obtained from Parkson Co. (Shanghai, China). For the confirmation of primer specificity, a dissociation curve for each primer pair was analyzed. Each sample was repeated three times for each gene.
3
Real-Time PCR for Viral RNA/DNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted, reverse-transcribed, and analyzed by real-time PCR using the SYBR Green Real-Time PCR Master Mix Kit (Roche). Virion DNA and viral genomic DNA were isolated and detected by real-time PCR as described previously [63 (link), 64 (link)]. The primers used for real-time PCR analysis were described previously [65 (link)] or designed using PrimerBank [66 (link)].
4
Quantitative Real-Time PCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol reagent (Invitrogen, Carlsbad, CA) was used to extract RNA from tissues and cells. AMV reverse transcriptase (Promega, Madison, WI, USA) was adopted to reversely transcribe 2 μg total RNA into cDNA, and then qRT-PCR was performed with SYBR Green RealTime PCR Master Mix kit (Roche, Basel, Switzerland) in ABI 7900 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA), and finally, relative RNA expression was estimated by the 2–ΔΔCt method. The primer sequences are listed in Table 1 .
The Primers Used in This Study
| Forward | Reverse | |
|---|---|---|
| GAPDH | 5′‐AGAAGGCTGGGGCTCATTTG‐3′ | 5′‐AGGGGCCATC CACAGTCTTC‐3′ |
| U6 | 5′-CTCGCTTCGGCAGCACA-3′ | 5′-AACGCTTCACGAATTTGCGT-3′ |
| miR-129-5p | 5ʹ-CGGCGGTTTTTTGCGGTCTGGGCT-3’ | 5ʹ-AGCCCAGACCGCAAAAAACCGCCG-3’ |
| PITPNA-AS1 | 5′-GCAGGGTGGATAAAGAGGA-3′ | 5′- CCTACTGACAGGATGTCCT-3′ |
| HMGB1 | 5′-GATGGGCAAAGGAGATCCTA-3′ | 5′-CTTGGTCTCCCCTTTGGGGG-3′ |
5
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The qRT-PCR was subsequently carried out to quantify the levels of genes expression. The total RNA was extracted from the fungal mycelium after being grown in a 1 L fermenter for 24 h. The qRT-PCR was performed using specific primers (Supplementary Materials Table S1 ) and the SYBR Green Realtime PCR Master Mix kit (Roche). The actin gene of M. circinelloides was served as the housekeeping gene. All the data were analyzed through relative quantification for qRT-PCR (2−ΔΔCt).
6
Quantitative Analysis of Nitrogen Metabolism Genes in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from root and shoot samples using an RNeasy Plant Mini Kit (Yeasen) and converted to cDNA using Rever Tra Ace qPCR RT Master Mix with gDNA remover (Yeasen) following the manufacturer’s protocol. The cDNA was amplified using the SYBR Green Real-Time PCR Master Mix Kit (KAPA) and quantitative real-time PCR was performed using a Quant Studio TM 6 Flex System (Applied Biosystems, Foster City, CA, USA) with specific gene primers for OsNRTs, OsAMTs, OsNAR, OsNiR2, OsGS1;1, OsGS1;2, OsGS2, OsFd-GOGAT, and OsZIPs (Supplementary Table S1). The relative gene expression levels were normalized using an internal standard (OsUbiquitin) and calculated using the 2−ΔΔCt method with CFX Manager Software (Bio-Rad).
7
Quantitative Real-Time PCR Analysis of Copper and Nitrogen Responsive Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from root and shoot samples using a RNeasy Plant Mini Kit (Yeasen, Shanghai, China) and converted to cDNA using the Rever Tra Ace qPCR RT Master Mix with a gDNA remover (Yeasen, Shanghai, China) following the manufacturer’s protocol. The cDNA was amplified using the SYBR Green Real-Time PCR Master Mix Kit (KAPA, Boston, USA) following the manufacturer’s protocol. The reaction was added with 2.0 μL of cDNA, 0.2 μL of forward primer, 0.2 μL of reverse primer, 5.0 μL of SYBR Green, and 2.6 μL of ddH2O. The quantitative real-time PCR was performed using a Quant Studio TM 6 Flex System (Applied Biosystems, Foster City, CA, USA) with specific gene primers (Supplementary Table S1 ). The reaction was performed as 95 °C 10 s, 60 °C 20 s, and 72 °C 20 s, for 40 cycles. The relative gene expression levels were normalized using an internal standard (OsUbiquitin) and calculated using the 2−ΔΔCt method with CFX Manager Software (Bio-Rad, CA, USA). The fold changes of N-related genes were calculated as the expression levels of each gene under +Cu conditions/the expression levels of each gene under -Cu conditions; the fold changes of Cu-related genes were calculated as the expression levels of each gene under +N conditions/the expression levels of each gene under -N conditions.
8
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cell lines using Trizol reagent (SRL, India). Total RNA was reverse-transcribed to cDNA using M-MuLV Reverse Transcriptase (NEB, USA) and random primer (NEB, USA). qRT-PCR was performed using a SYBR Green Realtime PCR Master Mix Kit (KAPA Biosystems, USA) in a StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA). Beta-actin was used as a housekeeping gene. Relative fold change in gene expression were calculated using 2-ΔΔCt method, normalized with respective controls.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!