Rat CPT-1A mRNA primers were as follows: forward: CTGCATGGAAGATGCTTTGA, reverse: GCCATGACATACTCCCACAA; mouse CPT-1A mRNA primers were as follows: forward: GCTGCACTCCTGGAAGAAGA, reverse: GGAGGGGTCCACTTTGGTAT; and mouse/rat β-actin mRNA primers were as follows: forward: CAGCTGAGAGGGAAATCGTG, reverse: CTCCAGGGAGGAAGAGGATG.
Quanta qscript
Quanta qScript is a reverse transcription reagent kit designed for cDNA synthesis from RNA samples. The kit contains a recombinant reverse transcriptase enzyme, optimized reaction buffer, and necessary components for efficient conversion of RNA to complementary DNA.
Lab products found in correlation
3 protocols using quanta qscript
Quantifying Gene Expression by qRT-PCR
Rat CPT-1A mRNA primers were as follows: forward: CTGCATGGAAGATGCTTTGA, reverse: GCCATGACATACTCCCACAA; mouse CPT-1A mRNA primers were as follows: forward: GCTGCACTCCTGGAAGAAGA, reverse: GGAGGGGTCCACTTTGGTAT; and mouse/rat β-actin mRNA primers were as follows: forward: CAGCTGAGAGGGAAATCGTG, reverse: CTCCAGGGAGGAAGAGGATG.
RNA Isolation and RT-qPCR Quantification
Characterization of M1 and M2 Macrophages
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!