All mouse protocols were in accordance with Cold Spring Harbor Laboratory’s Institutional Animal Care and Use Committee guidelines. The mild Hung mouse model (Smn−/−; SMN22TG/2TG) was the strain FVB.Cg-Tg(SMN2)2HungSMN1tm1Hung/J, founder line 2, purchased from Jackson Laboratory (stock no. 005058). The severe SMA model (Smn−/−; SMN22TG/0) was generated as previously described (Hua et al. 2011 (link)). The oligonucleotide solutions were injected subcutaneously into the upper back or intracerebroventricularly with a 5-μL syringe and 33-gauge custom removable needle (Hamilton) as described (Hua et al. 2010 (link)).
Fvb cg tg smn2 2hung smn1tm1hung j
Manufactured by Jackson ImmunoResearch
Sourced in United States
FVB.Cg-Tg(SMN2)2Hung Smn1tm1Hung/J is a transgenic mouse model. It expresses human survival motor neuron 2 (SMN2) gene and carries a targeted mutation in the mouse survival motor neuron 1 (Smn) gene.
Automatically generated - may contain errors
11 protocols using fvb cg tg smn2 2hung smn1tm1hung j
1
Mouse Models of Spinal Muscular Atrophy
2
Treatment of SMA Mice with PMO25
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SMA transgenic mice, FVB.Cg-Tg(SMN2)2Hung Smn1tm1Hung/J, also called the Taiwanese model (35 (link)), were initially purchased from The Jackson Laboratory (TJL005058). Mice were bred and experimental procedures were carried out in the Biological Service Unit, University College London, in accordance with the Animals (Scientific Procedures) Act 1986.
Newborn SMA mice were subcutaneously injected with a single dose of PMO25 at 40 μg/g. Untreated SMA control mice were injected with a similar volume of saline as previously described (21 (link)).
Newborn SMA mice were subcutaneously injected with a single dose of PMO25 at 40 μg/g. Untreated SMA control mice were injected with a similar volume of saline as previously described (21 (link)).
3
Transgenic Mouse Model of Spinal Muscular Atrophy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Spinal muscular atrophy transgenic mice, FVB.Cg‐Tg (SMN2)2Hung Smn1tm1Hung/J, were purchased from the Jackson Laboratory (TJL005058). All the procedures conducted in mice were carried out in the Biological Services Unit, University College London Great Ormond Street Institute of Child Health, in accordance with the Animals (Scientific Procedures) Act 1986. Experiments were performed under Home Office project licence PPL 70/8389.
4
SMA Mouse Model Subcutaneous PMO25 Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All mouse experiments were performed according to protocols approved by University College London Biological Services and UK Home Office under the Animals (Scientific Procedures) Act 1986. The initial breeding pairs of SMA transgenic mice FVB.Cg-Tg(SMN2)2Hung Smn1tm1Hung/J, originally created by Hsieh-Li et al.,35 (link) were purchased from the Jackson Laboratory (TJL005058). The severe type I SMA-like mice, referred as “SMA-I ”, carry two copies of human SMN2 transgene with genotype (SMN2)2+ /–; Smn–/–; the mild type III SMA-like mice, referred as “SMA-III ”, carry four copies of human SMN2 transgene with genotype (SMN2)2+ /+; Smn–/–; and the heterozygous progeny with genotype (SMN2)2+ /–; Smn+/– is phenotypically unaffected and was used as unaffected littermate control, referred as “control ”. Subcutaneous injections in severe type I SMA-like mice were performed as described previously.6 (link) 40 µg/g PMO25 was injected subcutaneously in SMA-I mice at PND0. The treated mice were referred as “SMA-I + PMO25 ”.
5
Generating Smn1-Chp1 Mouse Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All mouse experiments were approved by LANUV NRW (reference number: 84-02.04.2014.A242). Taiwanese SMA mice [FVB.Cg-Tg(SMN2)2Hung Smn1tm1Hung/J, Stock Number 005058] (Hsieh-Li et al., 2000 (link)) were purchased from Jackson Laboratory. Vacillator mice (B6.Cg-CHP1vac) (Liu et al., 2013 (link)) were provided by Susan L. Ackerman, Howard Hughes Medical Institute and Jackson Laboratory, Bar Harbor, Maine. All mouse lines were backcrossed for seven generations to obtain a congenic C57BL/6 N background. Heterozygous Chp1vac/wt mice were crossed with Smnko/wt mice to generate Smnko/wt; Chp1vac/wt mice. To obtain all required genotypes within one breeding, we crossed Smnko/wt; Chp1vac/wt with Smnko/wt; SMN2tg/tg mice (Fig. 4 C). Genotyping for Smn1, SMN2 and Chp1 was performed as described (Ackermann et al., 2013 (link); Liu et al., 2013 (link)).
6
Taiwanese SMA Transgenic Mouse Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Taiwanese SMA transgenic mice FVB.Cg-Tg(SMN2)2Hung SMN1tm1/Hung /J, originally created by Hsieh-Li et al. [28 (link)], were purchased from Jackson Laboratory (TJL005058; Jackson Laboratory, Bar Harbor, ME). Mice were bred and experimental procedures were performed according to protocols approved by University College London (London, UK) Biological Services and UK Home Office under the Animals (Scientific Procedures) Act 1986. The severe SMA mice, with genotype of (SMN2)2+/-; Smn-/-, have two copies of human SMN2 transgene and homozygous knockout of endogenous mouse Smn, are referred to SMA mice in this study. The heterozygous non-phenotypic control mice, with genotype of (SMN2)2+/-; Smn+/-, are referred to control mice in this study.
7
Murine Models of Spinal Muscular Atrophy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Smn‐/‐;SMN2 (Jackson Laboratory), Smn‐/‐;SMN2+/+;SMNΔ7 and Smn2B/‐ (wild type BL/6J background)31 mouse lines were housed at the University of Ottawa Animal Facility and cared for according to the Canadian Council on Animal Care. Experimentation and breeding were performed under protocol OHRI‐1948 and OHRI‐1927. Smn+/‐ mice were crossed to Smn2B/2B mice to obtain Smn2B/+ and Smn2B/‐ animals. C57BL/6J wild‐type mice were bred separately. The Taiwanese Smn‐/‐;SMN2 (FVB/N background, FVB.Cg‐Smn1tm1HungTg(SMN2)2Hung/J from Jackson Laboratory #005058) and SOD1G93A mice (B6.Cg‐Tg(SOD1*G93A)1Gur/J from Jackson Laboratory #004435) were housed at the Biomedical Sciences Unit, University of Oxford or within Biological Research Resources at the University of Edinburgh. All experiments using mice in the UK were performed in accordance with the licensing procedures authorized by the UK Home Office (Animal Scientific Procedures Act 1986). All tissue for quantitative biochemical analysis were collected at the same time of the day to limit the effect of the circadian rhythm.
8
Spinal Cord Tissue Harvesting in SMA Mouse Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SMN-deficient mouse model FVB.Cg-Smn1tm1Hung Tg(SMN2)2Hung/J (Jackson #005058), reflecting later-onset SMA, homozygote for the murine SMN1 knockout, and the insert of human SMN2 (4 copies) were purchased from Jackson Laboratory (Bar Habor, ME, USA) and bred in the Animal Research Lab of the University Hospital Essen. Male mice were used for spinal cord tissue harvesting at postnatal days (P) 28 and P42. Age-matched male FVB/N mice served as control.
For cell culture experiments, FVB/N mice were used. For isolating and culturing of spinal astrocytes, FVB/N mice at P25 were sacrificed. For the isolation and culturing of spinal motor neurons, FVB/N mice were timely paired, and spinal cord tissue of embryonic day (E) 13.5 embryos were harvested.
All animals were kept on a 14/10 h light/dark cycle with water and standard food pellets available ad libitum.
All experiments were conducted under the animal welfare guidelines of the University Duisburg Essen. Furthermore, the use of the SMA mouse model was approved by the State Agency for Nature, Environment and Consumer Protection (LANUV) in North Rhine-Westphalia (reference number 81-02.04.2020.A335).
For cell culture experiments, FVB/N mice were used. For isolating and culturing of spinal astrocytes, FVB/N mice at P25 were sacrificed. For the isolation and culturing of spinal motor neurons, FVB/N mice were timely paired, and spinal cord tissue of embryonic day (E) 13.5 embryos were harvested.
All animals were kept on a 14/10 h light/dark cycle with water and standard food pellets available ad libitum.
All experiments were conducted under the animal welfare guidelines of the University Duisburg Essen. Furthermore, the use of the SMA mouse model was approved by the State Agency for Nature, Environment and Consumer Protection (LANUV) in North Rhine-Westphalia (reference number 81-02.04.2020.A335).
9
Immortalized Mouse Embryonic Fibroblast Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse work was performed in the Biomedical Sciences Unit at the University of Oxford as authorized by the UK Home Office (Animal Scientific Procedures Act 1986). Taiwanese SMA mice were bred and maintained as described on The Jackson Laboratory website and as described previously.36 (link),63 (link) MEFs were isolated from strain FVB.Cg-Smn1tm1HungTg(SMN2)2Hung/J (Jackson Laboratory; 005058), crossed with strain FVB.129P2(B6)-Smn1tm1Hung/J (Jackson Laboratory; 031678), using a method described previously.64
After 2 additional days of culturing in MEF culture medium, the cells were plated for ASO transfection. For the MEF lines with sufficient cell counts, duplicate wells were plated (one for transfection with the 5′ UTR ASO and one for transfection with the NTC ASO). Single wells were plated for the MEF lines with fewer cells. The MEFs were transfected with ASO using RNAi MAX as described above. 3 days later, the MEFs were collected in RIPA buffer and subsequently assayed by immunoblotting.
KO/D7;SMN2- and KO/F7-immortalized MEFs37 (link) shared by the Burghes lab were transfected with ASO and immunoblotted 2 days post-transfection.
After 2 additional days of culturing in MEF culture medium, the cells were plated for ASO transfection. For the MEF lines with sufficient cell counts, duplicate wells were plated (one for transfection with the 5′ UTR ASO and one for transfection with the NTC ASO). Single wells were plated for the MEF lines with fewer cells. The MEFs were transfected with ASO using RNAi MAX as described above. 3 days later, the MEFs were collected in RIPA buffer and subsequently assayed by immunoblotting.
KO/D7;SMN2- and KO/F7-immortalized MEFs37 (link) shared by the Burghes lab were transfected with ASO and immunoblotted 2 days post-transfection.
10
Generation of SMA Mouse Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Taiwanese SMA mice used in this study was a gift from Professor Hua Yimin at Soochow University and was originally purchased from the Jackson Laboratory (FVB.Cg-Smn1tm1HungTg (SMN2)2Hung/J, stock number 005058) [35 (link),99 (link)]. There are two genotypes of this mouse, severe (Smn-/-, SMN22tg/0) and mild (Smn-/-, SMN22tg/2tg). Severe and control mice (Smn+/-, SMN22tg/0) were sequenced in this project, generated by crossing Het knockout mice (Smn+/-) with mild Taiwanese mice (Smn-/-, SMN22tg/2tg). Genotyping of tail-end tissue from newborn mice was performed using the method described in One step mouse genotyping kit (PD101-01, vazyme, nanjing, china). A Primer pair (F: 5’-AGCCTGAAGAACGAGATCAGC-3’, R: 5’-GTAGCCGTGATGCCATTGTCA-3’) was used to detect the mutant allele. A primer pair (F: 5’- ATAACACCACCACTCTTACTC -3’, R: 5’- GTAGCCGTGATGCCATTGTCA -3’) was used to detect the wild-type allele. Three littermates of SMA or control mice were pooled into one sample for scRNA-seq. Bulk-seq was done in triplicates (n = 1 per group in SMA or control).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!