For confirming successful labeling of the Cas9-SNAP proteins with the BG-coupled oligonucleotides, BG-coupled and uncoupled oligonucleotides were mixed with either SpCas9-SNAP, SadCas9-SNAP or only the Cas9-SNAP proteins alone, reactions were incubated for one hour at 30°C. For the SNAP-Vista Green (NEB) substrate, the protein was incubated for 30 min on 30°C in the dark. After incubation, reactions (300 ng) were loaded on 6% SDS-PAGE gel and run at 80V for 160 min. Gels that were containing BG-Vista Green (NEB, SNAP-Vista Green), were imaged prior to silver staining. The green fluorescence signal of the SNAP-tag was detected with a UV transilluminator (Biorad). Subsequently, silver staining was completed using the Pierce Silver Stain Kit (Thermo Scientific) according to manufacturer instructions, and imaged with a UV transilluminator (Biorad).
Uv transilluminator
Manufactured by Bio-Rad
Sourced in United States, China
A UV transilluminator is a laboratory instrument used to visualize and analyze nucleic acid samples, such as DNA and RNA, that have been stained with fluorescent dyes. It emits UV light, typically at 254 nm or 302 nm wavelengths, which excites the fluorescent dyes and causes the nucleic acid samples to emit visible light, allowing them to be observed and documented.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (7 mentions)
Gotaq green master mix, by Promega (4 mentions)
Ecl kit, by Merck Group (4 mentions)
Ethidium bromide, by Merck Group (4 mentions)
Pvdf membrane, by Merck Group (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Protein ladder, by Bio-Rad (3 mentions)
β actin, by Abcam (3 mentions)
Sybr safe dna gel stain, by Thermo Fisher Scientific (3 mentions)
Agarose gel, by Thermo Fisher Scientific (3 mentions)
Coomassie stained, by Thermo Fisher Scientific (2 mentions)
Gf 1 ambiclean kit, by Vivantis Technologies (2 mentions)
Sanger nucleotide sequencing, by Macrogen (2 mentions)
Taq dna polymerase, by Vivantis Technologies (2 mentions)
Dna extraction kit, by Qiagen (2 mentions)
Ecl a and b, by Beyotime (2 mentions)
M iggκ bp hrp, by Santa Cruz Biotechnology (2 mentions)
Mouse anti β actin, by Santa Cruz Biotechnology (2 mentions)
Mouse anti p53, by Santa Cruz Biotechnology (2 mentions)
Immobilon nc, by Merck Group (2 mentions)
125 protocols using uv transilluminator
1
Cas9-SNAP Protein Labeling Validation
2
PFGE Analysis of Salmonella Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total 55 strains of S. Typhimurium (including 8 strains of human S. Typhimurium isolates) and 34 strains of S. Potsdam in different links of the goose production chain were analyzed by pulsed field gel electrophoresis (PFGE ). PFGE was performed according to the protocol of the Centers for Disease Control and Prevention with some modifications (Ribot et al., 2006 (link)). In brief, Salmonella isolates were streaked onto LB plates and incubated overnight at 37°C. The pathogen concentration was modulated with bacterial suspensions until a McFarland turbidity of 4.0∼4.5 was attained. DNA was digested with 50 U XbaI (Takara, Dalian, China) at 37°C for 3 h. The digested DNA was separated by electrophoresis in 0.5 × TBE buffer at 14°C for 20 h using a CHEF Mapper electrophoresis system (Bio-Rad, Hercules, CA). The pulse time was ramped from 2.16 to 63.8 s. In addition, a control strain of S. Braenderup (H9812), which served as a molecular weight standard, was processed with each batch of isolates. The gels were stained with ethidium bromide, and DNA patterns were visualized on a UV trans-illuminator (Bio-Rad, Hercules, CA). Dendrograms were created by BioNumerics software version 7.5 (Applied Maths, Kortrijk, Belgium), using the unweighted pair group method with arithmetic mean. The band-matching settings with optimization of 0.5% and position tolerance of 1.5% were applied.
3
Evaluating Antibody Conjugation and Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine linker oligo conjugation efficiency of antibodies, the reaction mixture was analysed using 10% SDS PAGE gel (Thermo Fisher Scientific, NW04122BOX) following manufacturer’s instructions. Controls, including unmodified antibodies and a protein ladder (Bio-rad, #1610375) were also used. Subsequently, the gel was Coomassie stained (Thermo Fisher Scientific, #24617) to visualize the protein bands. To determine efficiency of hybridization reaction, the annealing reaction mixture was analysed using a 4% agarose gel containing a DNA stain (Thermo Fisher Scientific, #S33102). The bands were visualized using a UV transilluminator (Bio-Rad laboratories, Hercules, California).
4
Evaluating Antibody Conjugation and Hybridization
5
Endophytic Bacteria Colonization Study
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR-based test of the endophytic bacteria M. testaceum D18::gfp was performed using gfp-specific primers (Rt F-5′GGCCGATGCAAAGTGCCGATAAA3′ and Rt R-5′ AGGGCGAAGAATCTCGTGCTTTCA3′). For the tissue colonization study, the root, shoot, and leaves of the treated plants were crushed separately and 1 mL water extract of each tissue was centrifuged to get the pellet. The resulting pellet was used for the isolation of total genomic DNA using the protocol of bacterial DNA isolation as described earlier. The composition of the reaction mixture, as well as reaction conditions, was the same as that used for the selection of gfp transformants. The PCR amplicon was separated on agarose gel amended with ethidium bromide and visualized with a UV trans-illuminator (BioRad Laboratories, CA, USA).
6
ISSR Molecular Marker Analysis of Syzygium cumini
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amount of DNA isolated was measured using agarose gel electrophoresis. Twenty-six ISSR markers (Table 2 ) were employed in the molecular marker analysis to characterize 16 distinct accessions of S. cumini plant samples. ISSR analysis was performed using genomic DNA at a concentration of 25 ng. DNA amplifications were performed using a thermocycler (PQ lab-Primus 96) for the ISSR analysis. One negative control (master mix with water in place of DNA template) was added to check for contamination in the experiment. All the molecular analyses were conducted in three replicates.
A submerged gel electrophoresis midi unit from Bangalore Genei Pvt. Ltd. was used for fractionating the PCR products on an agarose gel. A low-range DNA ruler was included on one side of the gel as a molecular standard. The gel was visualized on a UV transilluminator (Bio-Rad, USA), photographed, and analyzed using the Kodak gel documentation system (Model EDAS 290) using Kodak ID Image analysis software.
A submerged gel electrophoresis midi unit from Bangalore Genei Pvt. Ltd. was used for fractionating the PCR products on an agarose gel. A low-range DNA ruler was included on one side of the gel as a molecular standard. The gel was visualized on a UV transilluminator (Bio-Rad, USA), photographed, and analyzed using the Kodak gel documentation system (Model EDAS 290) using Kodak ID Image analysis software.
7
Quantifying Plxnd1 Expression in GN11 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was collected from GN11 cells and retrotranscribed to cDNA as previously described [45 (link)]. RT-PCR was performed using 50 ng of cDNA, the Quick-Load® Taq 2X Master Mix (New England Biolabs, Ipswich, MA, USA) and specific primers for Plxnd1 (FW 5′-TCCTAGACAGCCCTAACCCC-3′ and REV 5′-AGGCTCAATCGCTCGGATTT-3′) [27 (link)]. Amplification products were separated by 1% agarose gel electrophoresis and detected by ethidium bromide fluorescence on a UV transilluminator (Bio-Rad Laboratories).
8
PCR Genotyping for ACE Insertion/Deletion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR was performed with a reaction volume of 12.5 µL and contained template DNA (50 ng), Fo—0.12 µL, R0—0.12 µL, RI—0.14 µL, and RI—0.14 µL of 10 pmol of each primer, as well as 6 µL from the GoTaq® Green Master Mix (cat no M7122) (Promega Corp. Madison, WI, USA). The final volume of 12.5 µL was adjusted by adding nuclease-free double distilled water (ddH2O). Finally, 2 µL of DNA was added from each patient. The thermocycling conditions used were: 95 °C for 8 min, followed by 45 cycles at 94 °C for 30 s, an annealing temperature of 58 °C for 45 s and 72 °C for 50 s, followed by the final extension at 72 °C for 10 min. The PCR products were separated on a 2.5% agarose gel stained with 3 µL of sybre safe stain (Thermo Scientific, Waltham, MA, USA) and visualized on a UV trans illuminator from Bio-Rad (Hercules, CA, USA) to visualize three patterns: I/I (490-bp fragment), D/D (190-bp fragment), and I/D (both 490- and 190-bp fragments), as depicted in Figure 1 .
9
Western Blot Analysis of KLF6, KLF15
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total proteins (30 μg) from tumor lysates were separated by 12% SDS-PAGE gel, followed by transferring to PVDF membranes (Millipore, Billerica, MA, USA). The primary antibodies KLF6 (1:300, 67,297–1, Proteintech, China), KLF15 (1:300, ab22851, Abcam, UK),and GAPDH (1:800, ab8245, Abcam, UK) were used to incubate with the membrane at 4 °C overnight. After incubation for 1 h with the HRP-conjugated secondary antibody, an ECL Kit (Millipore) and a UV Transilluminator (Bio-Rad) were used to acquire and analyze the protein band intensities.
10
Identification of S. agalactiae by 16S rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR reaction mixture of 16s rRNA was done in 25 µl total reaction using ×2 MyTaq mix (Bioline, UK) with 10 µM of each primer. Negative control served as non-template mixture [19 ]. The gDNA of the isolate was amplified for 16S rRNA by bacterial universal primers 8F (5’-GTTTACCTTGTTACGACTT-3’) and 1492R (5’-AGAGTTTGATCCTGGATGCTCAG-3’). The PCR reaction was performed in a Biothermal cycler (Bio-Rad, USA) with an initial denaturing step at 95°C for 5 min; 26 cycles of 95°C for 30 s, 55°C for 1 min and 72°C for 2 min; followed by 72°C for 10 min. 6 µl of the amplified products were electrophoresed by 1.2% (w/v) agarose gel in ×1 TBE electrophoresis buffer. Standard DNA ladder, 1 and 100 bp (Invitrogen, Germany) were used to confirm the size of the amplified PCR products at 1500 bp. The gel was stained with ethidium bromide (Promega, USA) and documented by UV-transilluminator (Bio-Rad, USA). Sequences obtained were analyzed and compared with sequences from GenBank using BLAST NCBI citation (http://blast.ncbi.nlm.nih.gov ). The accession number of the S. agalactiae was deposited in GenBank.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!