The largest database of trusted experimental protocols

Qiazol

Manufactured by Qiagen
Sourced in Germany, United States, United Kingdom, Netherlands, Spain, Switzerland, Italy, Canada, France, Japan, China, Australia

Qiazol is a liquid reagent used for the isolation and purification of total RNA from a variety of biological samples, including cells, tissues, and body fluids. It is designed to facilitate the effective extraction and preservation of RNA molecules.

Automatically generated - may contain errors

1 259 protocols using qiazol

1

Isolation and Quantification of Sciatic Nerve RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Frozen SNs were freed of peri‐ and epineurial layers and homogenized in 20 μl Qiazol (Qiagen) using chilled pestles. After addition of another 480 μl of Qiazol, total RNA was extracted according to the Qiazol manufacturer's instructions (Qiagen). RNA precipitation was enhanced using GlycoBlue Coprecipitant (Thermo Scientific). Taqman miRNA assays were performed according to manufacturer's instructions using 2–5 ng total RNA input (Applied Biosystems). Reverse transcription of total RNA was performed using 50–100 ng input with Maxima First Strand cDNA Synthesis Kit (Thermo). Subsequent quantitative real‐time PCR was performed with 2× FastStart Essential DNA Green Master Mix (Roche) on a Lightcycler 480II (Roche) using 2 μl 1:10 diluted total cDNA. PCR reactions were carried out with a minimum of three technical replicates per sciatic nerve sample. Primer sequences are supplied in Supporting Information, Table S2.
+ Open protocol
+ Expand
2

Caenorhabditis elegans Extracellular Vesicle Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The extracellular vesicles were prepared as reported13 (link),62 (link). In brief, ~200,000 worms were washed by M9 to remove excess bacteria and cultured in 60 ml M9 at 20 °C for 6 h with shaking at 180 rpm. Worms were then sedimented by gravity, and larvae were depleted by centrifugation at 4000 rpm for 5 min. Sedimented worms were collected into QIAzol (QIAGEN). The supernatant was collected and filtered by a 0.22 μm Millex-GP Syringe Filter Unit (Millipore) and then centrifuged at 25,000 g at 4 °C for 30 min. The supernatant was further subjected to ultracentrifuge twice at 100,000 g at 4 °C for 30 min. Sedimented EVs were resuspended in PBS for quality control or in QIAzol (QIAGEN) for miRNA-Seq. Worms or EVs collected in QIAzol (QIAGEN) were subjected to miRNA preparation using miRNeasy Mini kit (QIAGEN)11 (link).
+ Open protocol
+ Expand
3

RNA Extraction from Mouse Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed in Qiazol (QIAGEN) and total RNA was purified using the miRNEasy mini kit (QIAGEN) according to the manufacturer’s instructions. Tissues were lysed in Qiazol (QIAGEN) and total RNA was purified using Tissuelyser II (QIAGEN), as per the manufacturer’s instructions. Small RNAs (<200nt) size-fractionated using RNA Clean & Concentrator 5 column kits (Zymo), as per the manufacturer’s instructions. Testes of 8 weeks old mice were grinded under liquid nitrogen and RNA was extracted using Trizol (Thermo Fisher Scientific) according to the manufacturer’s instructions but using 80% EtOH during the wash step.
+ Open protocol
+ Expand
4

Gene Expression Analysis in Cardiac Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
NRVMs were homogenized in Qiazol (Qiagen), and RNA was extracted as per manufacturer’s protocol. Human RV samples were homogenized in Qiazol, RNA was extracted using the RNeasy plus mini kit (Qiagen), and following extraction, RNA was treated with TURBO DNase (Thermo Fisher Scientific) as per manufacturer’s protocol. cDNA was synthesized by using the Verso cDNA synthesis kit (Thermo Fisher Scientific) according to manufacturer’s instructions. Gene expression was measured by RT-qPCR as described27 (link), with Power Sybr Green PCR Master Mix (Life Technologies). Expression levels of all transcripts were normalized to 18S rRNA, and all RT-qPCR data are represented on a Log2 scale. RT-qPCR primers sequences are listed in supplemental Table S2.
+ Open protocol
+ Expand
5

RNA Extraction from Cell Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated using the miRNeasy Kit (Qiagen), according to the manufacturer’s protocol. Pellets of cells or EVs were resuspended in 700 μl of Qiazol (Qiagen), whereas 800 μl of Qiazol were added to 200–300 μl of liquid samples, such as cell supernatants or SEC fractions. Samples were vortexed for 10 sec, incubated at RT for 5 min, frozen on dry ice, and stored at -80°C.
For RNA extraction, samples were thawed on ice. 2 μl of RNA-grade glycogen (Thermo scientific) were added to improve RNA recovery. We also added 10 μl (107 copies) of the synthetic Caenorhabditis elegans miRNA cel-miR-39 (5′-UCACCGGGUGUAAAUCAGCUUG-3’; Metabion) as spike-in control RNA since it has no mammalian homologue. 0.2 volumes of chloroform were added to each sample and mixed by vortexing for 10 sec. We then followed the manufacturer’s protocol, including also the optional step of washing with the RWT buffer. The RNA was resuspended in 30 μl of nuclease-free water (Peqlab) in Eppendorf LoBind microcentrifuge tubes.
+ Open protocol
+ Expand
6

High-Quality RNA Isolation from Tissue Biopsy

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from 50 mg of biopsy samples using QIAzol (Qiagen, UK). Tissue samples were homogenised in 1 mL of QIAzol reagent using a rotor-strator tissue lyser (Qiagen, UK) and chloroform (Sigma-Aldrich Ireland, Dublin, Ireland). RNA was subsequently precipitated and purified using the RNeasy plus Universal kit (Qiagen, UK) according to the manufacturer’s guidelines, which included a step to remove any contaminating genomic DNA. The quantity of the RNA isolated was determined by measuring the absorbance at 260 nm using a Nanordrop spectrophotometer ND-1000 (Nanodrop Technologies, Wilmington, DE, USA). RNA quality was assessed on the Agilent Bioanalyser 2100 using the RNA 6000 Nano Lab Chip kit (Agilent Technologies Ireland Ltd., Dublin, Ireland). RNA quality was also verified by ensuring all RNA samples had an absorbance (A260/280) of between 1.8 and 2.0 and RIN (RNA integrity number) values of between 8 and 10 were deemed high quality. Any samples that had an (A260/280) absorbance of less than 1.8 were cleaned using Zymo Research RNA clean & concentrator kit (Cambridge Biosciences, UK). High quality RNA samples were selected for cDNA synthesis.
+ Open protocol
+ Expand
7

Chicken Muscle RNA Isolation Using QIAzol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from chicken muscle samples using QIAzol lysis reagent (Qiagen Inc., Valencia, CA, USA) according to the manufacturer’s instruction with a slight modification. Briefly, 200 mg of frozen chicken skeletal muscle was ground thoroughly into powder using a sterile mortar and pestle. The tissue powder was homogenized with 2.5 mL of QIAzol (Qiagen Inc., USA) for 40 s, and the homogenate was subsequently centrifuged at 12,000×g for 10 min, 4°C. The supernatant was mixed with 0.2 vol of chloroform and subsequently centrifuged at 12,000×g for 10 min at 4°C. The isolated RNA was precipitated by mixing 500 μL of the aqueous phase with an equal volume of isopropanol followed by centrifugation at 12,000×g for 8 min, 4°C. The RNA pellet was collected, washed with 75% ethanol and re-suspended in nuclease-free water. The isolated RNA was treated with DNase I (Thermo Fisher Scientific Inc., Waltham, MA, USA) following company’s protocol to remove any contaminated genomic DNA, and re-purified using QIAzol (Qiagen Inc., USA) according to the company’s instruction. Quantity of total RNA was measured using a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc., USA). Purity of the isolated RNA was determined according to relative absorbance at 260 nm to 280 nm (A260/A280), and at 260 nm to 230 nm (A260/A230).
+ Open protocol
+ Expand
8

miRNA Extraction from Serum

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from serum according to the protocol recommended by Exiqon (Vedbæk, Denmark). In brief, we first made QIAzol Master Mix by adding 1.25 µL 0.8 µg/µL MS2 bacterophage RNA to 800 µL QIAzol (QIAGEN Sciences, Germantown, MN). We then added 750 µL QIAzol Master Mix to 200 µL serum and extracted miRs by the use of chloroform, ethanol, spin columns, and RNase free water. Cel-miR-39 was included as a spike-in control to assess the efficiency of RNA extraction.
+ Open protocol
+ Expand
9

Quantification of Immune Genes in Viral Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell culture samples were directly harvested in QIAzol (Qiagen). Tissue samples were harvested in QIAzol (Qiagen) and homogenized using a TissueLyzer II (Qiagen). Total RNA was extracted according to the manufacturer’s instructions (79306, Qiagen). The First Strand cDNA Synthesis Kit (K1612, Thermo Fisher Scientific) was used to reverse transcribe the isolated RNA into cDNA. For gene expression analyses via real-time polymerase chain reaction (PCR), Taqman Fast Universal PCR Mastermix (4352042, Thermo Fisher Scientific) and Taqman Gene Expression Assays (Thermo Fisher Scientific) for Tdo2 (Mm00451269_m1), Ido1 (Mm00524210_m1), Ido2 (Mm004925901_m1) and Ifit1 (Mm00515153_m1) were used. Expression levels of LCMV NP (5’-CAAGTATTCACACGGCATGGA-3’, 5’-TGGGAGAGCACCTATAACTGATA-3’ and 5’-[6FAM]TGATCTCTTCAATGCACAGCCTGGGC[BHQ1]-3’) and Ef1α (5’-GCAAAAACGACCCACCAATG-3’, 5’-GGCCTTGGTTCAGGATA-3’, and 5’-[6FAM]CACCTGAGCAGTGAAGCCAG[TAM]-3’) were measured by corresponding probe and primer sets as described previously [22 (link)].
+ Open protocol
+ Expand
10

Frozen Cortex RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Frozen cortex was homogenized in QIAzol (QIAGEN) using a sterile, nuclease-free handheld homogenizer (Bel-art) for approximately 30 seconds on ice. Samples then sat at room temperature for 5 minutes and then were mixed vigorously with chloroform at 1:5 ratio (chloroform/QIAzol) and allowed to sit for 10 minutes at room temperature. Sample mixtures were then spun down at 12,000g for 10 minutes at 4°C. The aqueous layer of RNA was then carefully removed, gently mixed with 70% EtOH/original volume of QIAzol (1:1), and run through an RNeasy spin column (QIAGEN) according to manufacturer’s protocol.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!