Alamut visual v2

Manufactured by Sophia Genetics

Sourced in France

Alamut Visual v2.11 is a genomic visualization tool designed for the analysis and interpretation of DNA sequence data. It provides a comprehensive platform for viewing, annotating, and analyzing genetic variants within the context of genomic information.

Automatically generated - may contain errors

Lab products found in correlation

Nextgene v2, by SoftGenetics (2 mentions) Pymol molecular graphics system version, by Schrödinger (1 mentions) Clampfit 10, by OriginLab (1 mentions) Originpro 2016, by OriginLab (1 mentions)

18 protocols using alamut visual v2

Comprehensive Genetic Analysis of PAX6 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

All patients gave informed written consent for genetic testing. Direct Sanger sequencing of the PAX6 gene (Genbank accession NM_000280.4/ENST00000643871.1 was used for variant nomenclature and exon numbering) was performed at the NHS Wessex Regional Genetics Laboratory and the Rare & Inherited Disease Genomic Laboratory at Great Ormond Street Hospital. Variant analysis, including pathogenicity prediction and novelty, was performed using Alamut Visual v.2.15 (Interactive Biosoftware) and the publicly available Leiden Open Variation Database PAX6 Mutation Database (http://lsdb.hgu.mrc.ac.uk/home.php?select_db=PAX6). The Wessex Regional Genetics Laboratory recently published all novel PAX6 variants, including those from patients in our cohort; after which only 1 novel variant remained, and it has been submitted to ClinVar.

Kit V., Cunha D.L., Hagag A.M, & Moosajee M. (2021). Longitudinal genotype-phenotype analysis in 86 patients with PAX6-related aniridia. JCI Insight, 6(14), e148406.

+ Open protocol

+ Expand

Exon Skipping Prediction Tools

Check if the same lab product or an alternative is used in the 5 most similar protocols

The ESE finder 3.0 (http://rulai.cshl.edu/tools/ESE/) was used for ESE motif prediction and EX-SKIP (https://ex-skip.img.cas.cz) program was used to calculate the total number of ESSs, ESEs and their ratio. ESE finder and RESCUE-ESE were visualized using exon skipping in Alamut Visual v.2.15 (Interactive Biosoftware, Rouen, France).

Lee J., Jeong H., Won D., Shin S., Lee S.T., Choi J.R., Byeon S.H., Kuht H.J., Thomas M.G, & Han J. (2022). Noncanonical Splice Site and Deep Intronic FRMD7 Variants Activate Cryptic Exons in X-linked Infantile Nystagmus. Translational Vision Science & Technology, 11(6), 25.

+ Open protocol

+ Expand

Predicting Splicing Effects via Alamut

Check if the same lab product or an alternative is used in the 5 most similar protocols

A splicing effect of detected mutation was predicted via the Alamut Visual v.2.11 software (Interactive Biosoftware, Rouen, France) by using following algorithms; SpliceSiteFinder-like, MaxEntScan, NNSPLICE, and GeneSplicer.

Wu J., Zhang J., Liu L., Zhang B., Yamamura T., Nozu K., Matsuo M, & Zhao J. (2021). A disease-causing variant of COL4A5 in a Chinese family with Alport syndrome: a case series. BMC Nephrology, 22, 380.

+ Open protocol

+ Expand

Bioinformatics Analyses for Variant Prediction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bioinformatics prediction analyses were performed using AGVGD, DANN, DEOGEN2, EIGEN, FATHMM, LRT, MAPP, M‐CAP, METALR, METASVM, VARIANTASSESSOR, VARIANTTASTER, MVP, PRIMATEAI, PROVEAN, REVEL, and SIFT. All algorithms were integrated into Alamut® Visual v2.11 software (Interactive Biosoftware, France) or at the Varsome website (http://varsome.com). Prediction of translation initiation sites was performed by DNA TIS Miner (http://dnafsminer.bic.nus.edu.sg/) and ATGpr (http://atgpr.dbcls.jp/).

Wu D., Wang Y, & Huang H. (2020). A novel variant of the IFITM5 gene within the 5′‐UTR causes neonatal transverse clavicular fracture: Expanding the genetic spectrum. Molecular Genetics & Genomic Medicine, 8(7), e1287.

+ Open protocol

+ Expand

Structural Analysis of Genetic Variants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Structural analysis of variants was performed using Pymol (The Pymol Molecular Graphics System, Version 2.5, Schrödinger, LLC). All Figures were generated using Pymol. Four in silico prediction algorithms were consulted: Sorting Intolerant from Tolerant, Metadome, MutationTaster, and Polymorphism Phenotyping v2.^{26 (link)–29 (link)} All variants were manually analyzed using Alamut Visual v2.15 (Sophia Genetics). Variants were classified according to the 2015 American College of Medical Genetics and Genomics/Association for Molecular Pathology guidelines.^{30 (link)} Episign results were used to support classification according to criterium Pathogenic Strong 3 (PS3), and Pathogenic Moderate 1 (PM1) was applied for variants in the CxxC domain.

van Jaarsveld R.H., Reilly J., Cornips M.C., Hadders M.A., Agolini E., Ahimaz P., Anyane-Yeboa K., Audebert Bellanger S., van Binsbergen E., van den Boogaard M.J., Brischoux-Boucher E., Caylor R.C., Ciolfi A., van Essen T.A., Fontana P., Hopman S., Iascone M., Javier M.M., Kamsteeg E.J., Kerkhof J., Kido J., Kim H.G., Kleefstra T., Lonardo F., Lai A., Lev D., Levy M.A., Lewis M.E., Lichty A., Mannens M.M., Matsumoto N., Maya I., McConkey H., Megarbane A., Michaud V., Miele E., Niceta M., Novelli A., Onesimo R., Pfundt R., Popp B., Prijoles E., Relator R., Redon S., Rots D., Rouault K., Saida K., Schieving J., Tartaglia M., Tenconi R., Uguen K., Verbeek N., Walsh C.A., Yosovich K., Yuskaitis C.J., Zampino G., Sadikovic B., Alders M, & Oegema R. (2022). Delineation of a KDM2B-related neurodevelopmental disorder and its associated DNA methylation signature. Genetics in medicine : official journal of the American College of Medical Genetics.

+ Open protocol

+ Expand

Molecular Diagnosis of NF1 Patients

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Individuals who were NF1 NMI after routine DNA‐based molecular screening (van Minkelen et al., 2014 (link)) and met diagnostic criteria for NF1, and for whom a molecular diagnosis was considered useful or important, were included in the study. Clinical and genetic information was extracted from the Erasmus MC Department of Clinical Genetics NF1 patient database. Nomenclature for all reported variants was according to the current Human Genome Variation Society guidelines and NM_000267.3(NF1) is used throughout this manuscript as the reference transcript. Variants were classified according to American College of Medical Genetics guidelines (Richards et al., 2015 (link)) using splice prediction software (Alamut Visual v.2.15; Sophia Genetics) and the available clinical, genetic, and functional data. Clinical characteristics are summarized in Supporting Information: Table S1. Routine DNA‐based molecular screening of NF1 and, in some cases, SPRED1 by Sanger sequencing and MLPA did not identify the causative variant in any of the individuals in the cohort. All individuals or their legal representatives provided verbal and/or written consent for diagnostic testing.

Douben H.C., Nellist M., van Unen L., Elfferich P., Kasteleijn E., Hoogeveen‐Westerveld M., Louwen J., van Veghel‐Plandsoen M., de Valk W., Saris J.J., Hendriks F., Korpershoek E., Hoefsloot L.H., van Vliet M., van Bever Y., van de Laar I., Aten E., Lachmeijer A.M., Taal W., van den Bersselaar L., Schuurmans J., Oostenbrink R., van Minkelen R., van Ierland Y, & van Ham T.J. (2022). High‐yield identification of pathogenic NF1 variants by skin fibroblast transcriptome screening after apparently normal diagnostic DNA testing. Human Mutation, 43(12), 2130-2140.

+ Open protocol

+ Expand

Sanger Sequencing of SNORD118

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mutational analysis was performed using standard Sanger sequencing. Primers were designed to generate a 297 base-pair amplicon around SNORD118 (SNORD118-Forward: CGCGTTATGAACTCACCCTA; SNORD118-Reverse: CAGCAAGGTTATCCCAGTCAG). Mutation description is based on the reference sequence NR_033294.1. Population allele frequencies were accessed from the Genome Aggregation Database (gnomAD) (http://gnomad.broadinstitute.org) using Alamut Visual v.2.15 (SOPHiAGENETICS.COM). Rare alleles were defined as those with a frequency of <0.005 on gnomAD. Note that whilst SNORD118 is a 136 nucleotide snoRNA, it is annotated on gnomAD as 134 nucleotides in length i.e. not including an extra nucleotide of transcribed sequence at both the 5' and 3' ends.
Furthermore, gnomAD designates the 5' region and 3' extension of U8 to lie within the 3' UTR of TMEM107.

Crow Y.J., Marshall H., Rice G.I., Seabra L., Jenkinson E.M., Baranano K., Battini R., Berger A., Blair E., Blauwblomme T., Bolduc F., Boddaert N., Buckard J., Burnett H., Calvert S., Caumes R., Ng A.C., Chiang D., Clifford D.B., Cordelli D.M., de Burca A., Demic N., Desguerre I., De Waele L., Di Fonzo A., Dunham S.R., Dyack S., Elmslie F., Ferrand M., Fisher G., Karimiani E.G., Ghoumid J., Gibbon F., Goel H., Hilmarsen H.T., Hughes I., Jacob A., Jones E.A., Kumar R., Leventer R.J., MacDonald S., Maroofian R., Mehta S.G., Metz I., Monfrini E., Neumann D., Noetzel M., O'Driscoll M., Õunap K., Panzer A., Parikh S., Prabhakar P., Ramond F., Sandford R., Saneto R., Soh C., Stutterd C.A., Subramanian G.M., Talbot K., Thomas R.H., Toro C., Touraine R., Wakeling E., Wassmer E., Whitney A., Livingston J.H., O'Keefe R.T, & Badrock A.P. (2021). Leukoencephalopathy with calcifications and cysts: Genetic and phenotypic spectrum. American journal of medical genetics. Part A, 185(1).

+ Open protocol

+ Expand

Targeted Sequencing Validation Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Analysis was carried out using Ion Torrent Suite^™ Browser version 5.0 and Ion Reporter^™ version 5.0. The Torrent Suite^™ Browser was used to perform initial quality control including chip loading density, median read length and number of mapped reads. The Coverage Analysis plugin was applied to all data and used to assess amplicon coverage for regions of interest. Variants were identified by Ion Reporter filter chain 5% Oncomine^™ Variants (5.0). A cut off of 500X coverage was applied to all analyses. All identified variants were checked for correct nomenclature using Alamut Visual v.2.7.1 (Interactive Biosoftware). Any discrepancies in variant identification, between Ion Reporter and Alamut, were validated manually using the Integrative Genomics Viewer [4 (link), 5 (link)] and NextGENe® v2.4.2 (SoftGenetics®). For the purposes of this validation, amplicons covering clinically actionable regions with known mutation status (termed target amplicons; Table 1) were assessed as a subset of all amplicons (amplicons which target hot spot variants, i.e. SNVs and indels) covered in the Oncomine^™ Focus hot spot BED file.Table 1

Target amplicons

Table details ‘target amplicons’ per tissue type and number of amplicons covering each gene of interest based upon current clinical and EQA requirements within UKNEQAS and Molecular Pathology at the Royal Infirmary of Edinburgh

Williams H.L., Walsh K., Diamond A., Oniscu A, & Deans Z.C. (2018). Validation of the Oncomine™ focus panel for next-generation sequencing of clinical tumour samples. Virchows Archiv, 473(4), 489-503.

+ Open protocol

+ Expand

Variant Identification in NGS Data

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ion Torrent Suite™ Browser version 5.0 and Ion Reporter™ version 5.0 were used to analyze the NGS data. The Torrent Suite™ Browser was used to perform initial quality control, including chip loading density, median read length, and the number of mapped reads. The Coverage Analysis plugin was applied to all data to assess amplicon coverage for regions of interest. Variants were identified by the Ion Reporter filter chain 5% Oncomine™ Variants (5.0). A cut-off of 500X coverage was applied to all analyses. All identified variants were checked for correct nomenclature using Alamut Visual v.2.7.1 (Interactive Biosoftware). Any discrepancies in variant identification between Ion Reporter and Alamut were validated manually using the Integrative Genomics Viewer and NextGENe^® v2.4.2 (SoftGenetics^®) [32 (link), 33 (link)].

Chamorro D.F., Cardona A.F., Rodríguez J., Ruiz-Patiño A., Arrieta O., Moreno-Pérez D.A., Rojas L., Zatarain-Barrón Z.L., Ardila D.V., Viola L., Recondo G., Blaquier J.B., Martín C., Raez L., Samtani S., Ordóñez-Reyes C., Garcia-Robledo J.E., Corrales L., Sotelo C., Ricaurte L., Cuello M., Mejía S., Jaller E., Vargas C., Carranza H., Otero J., Archila P., Bermudez M., Gamez T., Russo A., Malapelle U., de Miguel Perez D., de Lima V.C., Freitas H., Saldahna E., Rolfo C, & Rosell R. (2023). Genomic Landscape of Primary Resistance to Osimertinib Among Hispanic Patients with EGFR-Mutant Non-Small Cell Lung Cancer (NSCLC): Results of an Observational Longitudinal Cohort Study. Targeted Oncology, 18(3), 425-440.

+ Open protocol

+ Expand

In Silico Variant Analysis Protocol

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The impact of missense variants at the protein level was analyzed using the in silico algorithms PolyPhen-2, SIFT, CONDEL, Mutation Taster and Align GVGD^{11 (link)–15 (link)}. The potential effects on splicing were evaluated by using Human Splice Finder v.3.0^{16 (link)}. Except for CONDEL, prediction data were provided by Alamut Visual v2.7.1 (Interactive Biosoftware, Rouen, France).

Belhadj S., Quintana I., Mur P., Munoz-Torres P.M., Alonso M.H., Navarro M., Terradas M., Piñol V., Brunet J., Moreno V., Lázaro C., Capellá G, & Valle L. (2019). NTHL1 biallelic mutations seldom cause colorectal cancer, serrated polyposis or a multi-tumor phenotype, in absence of colorectal adenomas. Scientific Reports, 9, 9020.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!