Allstars hs cell death sirna

Manufactured by Qiagen

Sourced in United States

The AllStars Hs Cell Death siRNA is a laboratory product designed to target and silence genes related to cell death mechanisms in human cells. It functions as a tool for researchers to study and investigate these cellular processes.

Automatically generated - may contain errors

Lab products found in correlation

Flexitube sirna, by Qiagen (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Opti mem, by Thermo Fisher Scientific (1 mentions) Hiperfect reagent, by Qiagen (1 mentions) Ambion silencer select, by Thermo Fisher Scientific (1 mentions) Silencer select, by Thermo Fisher Scientific (1 mentions) Hiperfect transfection reagent, by Qiagen (1 mentions) Sybr select master mix, by Thermo Fisher Scientific (1 mentions) Biolux gaussia luciferase flex assay kit, by New England Biolabs (1 mentions) Phusion site directed mutagenesis kit, by New England Biolabs (1 mentions) Transcriptor high fidelity cdna synthesis kit, by Roche (1 mentions) Phusion high fidelity dna polymerase, by New England Biolabs (1 mentions) Hiperfect, by Qiagen (1 mentions) Cellevent, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

AllStars Hs Cell Death Control siRNA AllStars Hs Cell Death AllStars Cell Death siRNA Cell Death siRNA AllStar siRNA AllStars siRNA AllStars SiRNAs

7 protocols using allstars hs cell death sirna

Knockdown of PLK1 in Cell Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNA oligonucleotides targeting PLK1 (FlexiTube siRNA, Qiagen, Cat. #: 1027416), a negative scrambled control (AllStars Negative Control siRNA, Qiagen, Cat. #: SI03650318), and a positive cell death control (AllStars Hs Cell Death siRNA, Qiagen, Cat. #: SI04381048) were used. Cells were seeded in 6-well plates at 2.5 × 10⁵ cells/well and 24 hours later transfected with siRNA (40 nmol/L final concentration) using Lipofectamine 2000 (Invitrogen) diluted in Opti-MEM (Invitrogen) according to the manufacturer’s instructions. Cells were left for 16 to 24 hours before being lysed for Western blotting or trypsinized and seeded in 96-well plates at 5 × 10³ cells/well in 100 µL of media. For comparison of siRNA with vinblastine, cells were seeded directly in 96-well plates at 1 × 10⁴ cells/well in 100 µL of media and transfected 24 hours later as described.

Atanasova V.S., Pourreyron C., Farshchian M., Lawler M., Brown CA I.V., Watt S.A., Wright S., Warkala M., Guttmann-Gruber C., Hofbauer J.P., Fuentes I., Prisco M., Rashidghamat E., Has C., Salas-Alanis J.C., Palisson F., Hovnanian A., McGrath J.A., Mellerio J.E., Bauer J.W, & South A.P. (2019). Identification of Rigosertib for the Treatment of Recessive Dystrophic Epidermolysis Bullosa–Associated Squamous Cell Carcinoma. Clinical cancer research : an official journal of the American Association for Cancer Research, 25(11), 3384-3391.

+ Open protocol

+ Expand

siRNA Knockdown of DDX56 in U2OS Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNAs for DDX56 and controls were obtained from Ambion (SilencerSelect) or Sigma (sequences are in Table S3 in the supplemental material). AllStars Hs Cell Death siRNA (1027299; Qiagen) was used to verify knockdown in each experiment, and specific knockdowns were compared to a nontargeting control siRNA (AM4613; Life Technologies). U2OS cells were transfected using HiPerFect reagent (301709; Qiagen) with a final siRNA concentration of 20 nM by following the manufacturer’s protocol. Two pooled siRNAs were used for DDX56 experiments, but we validated that each could independently knock down DDX56 and affect CHIKV infection. Cells were infected on day 3 posttransfection and collected at the indicated time points postinfection.

Taschuk F., Tapescu I., Moy R.H, & Cherry S. (2020). DDX56 Binds to Chikungunya Virus RNA To Control Infection. mBio, 11(5), e02623-20.

+ Open protocol

+ Expand

Transient transfection of cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

All three cell lines were transiently transfected using a final concentration of 50 nM of two different siRNAs targeting PANTR1 (siRNA 1 #n507582, siRNA 2 #n507583; Ambion Silencer Select, Ambion, Austin, TX, USA) according to the fast forward protocol of HiPerFect Transfection Reagent (Qiagen, Hilden, Germany). Non-targeting negative control siRNA (Silencer Select negative Control No.1 siRNA #4390843; Ambion Silencer Select, Ambion, Austin, TX, USA) and cell death control (AllStars Hs Cell Death siRNA # SI04381048, Qiagen, Hilden, Germany) served as references.

Seles M., Hutterer G.C., Foßelteder J., Svoboda M., Resel M., Barth D.A., Pichler R., Bauernhofer T., Zigeuner R.E., Pummer K., Slaby O., Klec C, & Pichler M. (2020). Long Non-Coding RNA PANTR1 is Associated with Poor Prognosis and Influences Angiogenesis and Apoptosis in Clear-Cell Renal Cell Cancer. Cancers, 12(5), 1200.

+ Open protocol

+ Expand

Silencing FAM83B in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNAs against FAM83B were purchased (Hs_FAM83B_8 and Hs_FAM83B_9 FlexiTube siRNA; Qiagen GmbH,, Hilden, Germany). Sequences of siRNAs were: Hs_FAM83B_8 (siRNA-8): 5′-CAGGAACGAGTTTCAGACTTT-3′, and Hs_FAM83B_9 (siRNA-9): 5′-TCCCGTTATTTGACAACTCAA-3′.
As a negative control, AllStars negative control siRNA (Qiagen GmbH,) was used. As a positive control, AllStars Hs Cell Death siRNA (Qiagen GmbH,) was used.

Yamaura T., Ezaki J., Okabe N., Takagi H., Ozaki Y., Inoue T., Watanabe Y., Fukuhara M., Muto S., Matsumura Y., Hasegawa T., Hoshino M., Osugi J., Shio Y., Waguri S., Tamura H., Imai J.I., Ito E., Yanagisawa Y., Honma R., Watanabe S, & Suzuki H. (2017). Family with sequence similarity 83, member B is a predictor of poor prognosis and a potential therapeutic target for lung adenocarcinoma expressing wild-type epidermal growth factor receptor. Oncology Letters, 15(2), 1549-1558.

+ Open protocol

+ Expand

Functional Role of CCND2 in Prostate Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

To further evaluate functional role of CCND2 in prostate cancer cell growth, we performed short interfering RNA (siRNA)-mediated knockdown assays by transfecting siRNAs against CCND2 into the DU145 cells that were seeded in 96-well palates (reverse transfection, 6pmol siRNA per well) using HiPerFect Transfection Reagent (Cat No: 301705). The siRNAs used included CCND2 siRNAs: AGGAGTGTAGTTGGATCTCTA (SI00027839); AAGAAATAGACTTGCACCTTA (SI00027853); CAGGGCCGTGCGGGACCGCAA (SI03071369) and AllStars Hs Cell Death siRNA (SI04381048) and AllStars Negative Control siRNA(SI03650318) purchased from Qiagen. We used qRT-PCR (SYBR Select Master Mix, 4472920, Applied Biosystems) to evaluate knockdown effect of the siRNAs on CCND2. Primer sequences used in this experiment are TCCTGGCCTCCAAACTCAAAG (CCND2 forward), GAGGCTTGATGGAGTTGTCG (CCND2 reverse) and AGAAAATCTGGCACCACACC (ACTB forward) and AGAGGCGTACAGGGATAGCA (ACTB reverse).

Chen Y., Zhang Q., Wang Q., Li J., Sipeky C., Xia J., Gao P., Hu Y., Zhang H., Yang X., Chen H., Jiang Y., Yang Y., Yao Z., Chen Y., Gao Y., Tan A., Liao M., Schleutker J., Xu J., Sun Y., Wei G.H, & Mo Z. (2017). Genetic association analysis of the RTK/ERK pathway with aggressive prostate cancer highlights the potential role of CCND2 in disease progression. Scientific Reports, 7, 4538.

+ Open protocol

+ Expand

DPYD 3'UTR Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

HCT116 RNA was reverse transcribed using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science) using oligo-d(T) primers. The 3′ 56 nucleotides of the open reading frame and the 3′UTR of DPYD were amplified by PCR (Phusion High-Fidelity DNA Polymerase, New England Biolabs, Ipswich, MA) using primers 5′-CAACACCTTATGAACCAAAGAGAGGC-3′ and 5′-ATGCTTTATGATATTTTATTTG-3′ and cloned into the pTK-Gluc vector (New England Biolabs). Mutations were introduced into the predicted microRNA seed-binding sites using the Phusion Site-Directed Mutagenesis Kit (New England Biolabs). Independent clonal cell lines stably expressing each of the reporter constructs were selected using G418 (Mediatech) following transfection of linearized plasmid. MicroRNA mimics and inhibitors were obtained from Qiagen (Valencia, CA) and transfected using HiPerFect (Qiagen) per manufacturer’s instructions. AllStars Hs Cell Death siRNA (Qiagen) was used as a transfection control and to establish residual luciferase activity at time of reading. Luciferase levels were measured after 48 hours using the BioLux Gaussia Luciferase Flex Assay Kit (New England Biolabs). Luciferase activity is reported relative to that for the scramble control. P values were determined using a two-tailed unpaired Student’s t-test.

Offer S.M., Butterfield G.L., Jerde C.R., Fossum C.C., Wegner N.J, & Diasio R.B. (2014). MicroRNAs miR-27a and miR-27b directly regulate liver dihydropyrimidine dehydrogenase expression through two conserved binding sites. Molecular cancer therapeutics, 13(3), 742-751.

+ Open protocol

+ Expand

Quantifying Apoptosis in Organoid Microbeads

Check if the same lab product or an alternative is used in the 5 most similar protocols

CellEvent (Invitrogen) staining was performed to detect activated Caspase-3/7 and to quantify apoptosis in organoids within Matrigel microbeads. Briefly, Matrigel microbeads were incubated 30 min at 37°C with 10 μM of Cell Event reagent. As a positive cell death control, Matrigel microbeads were transfected with siRNA Cell Death (AllStars Hs Cell Death siRNA from Qiagen, 20 nM). After Cell Event staining, Hoechst staining was performed and images were acquired using a High Content CellInsight Screening Platform (ThermoFischer Scientific) for all conditions. Analysis was performed using R software and the percentage of dead organoids was evaluated based on negative control levels (Supplementary Figure S2).

Laperrousaz B., Porte S., Gerbaud S., Härmä V., Kermarrec F., Hourtane V., Bottausci F., Gidrol X, & Picollet-D’hahan N. (2018). Direct transfection of clonal organoids in Matrigel microbeads: a promising approach toward organoid-based genetic screens. Nucleic Acids Research, 46(12), e70.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!